We narrowed to 29,785 results for: des.2
-
Plasmid#197801PurposeLevel 1 Module 2 destination vector (reverse orientation MoClo insert)DepositorTypeEmpty backboneUseUnspecifiedAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pDTnLAPP2A frame 2
Plasmid#28228DepositorInsertHygrophosphotransferase-P2A-Enhanced Green Fluorescent Protein
UseRetroviralTagsEGFP and nLAP-tagAvailable SinceSept. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
Hv_HPT:pCER6#2:Gus_introns
Plasmid#215200PurposeEvaluating guard cell specific promotors in BarleyDepositorInsert3-ketoacyl-coa synthase6
UseSynthetic BiologyExpressionPlantPromoterHvCER6#2Available SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-homo_PLA2G4A-2
Plasmid#184736PurposecPLA2-KO in HeLaDepositorInsertA gRNA targeting the human cPLA2 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMC-2-BsaI
Plasmid#197818PurposeLevel 1 module 2 with BsaI expansion pointDepositorInsertNone
UseUnspecifiedAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJMC-2-Esp3I
Plasmid#197830PurposeLevel 1 module 2 with Esp3I expansion pointDepositorInsertNone
UseUnspecifiedAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
Ssh1 gRNA#2
Plasmid#163395PurposeCas9-mediated knockout of Ssh1 in mammalian cellsDepositorAvailable SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ssh2 gRNA#2
Plasmid#163398PurposeCas9-mediated knockout of Ssh2 in mammalian cellsDepositorAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ssh3 gRNA#2
Plasmid#163401PurposeCas9-mediated knockout of Ssh3 in mammalian cellsDepositorAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBzCas13b-gRNA-2
Plasmid#164859PurposeConstitutive expression of single-spacer CRISPR array with spacer #2 targeting deGFP mRNA for BzCas13b in bacteria.DepositorInsertBzCas13b-gRNA-2
ExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLsCas13a-gRNA-2
Plasmid#164866PurposeConstitutive expression of single-spacer CRISPR array with spacer #2 targeting deGFP mRNA for LsCas13a in bacteria.DepositorInsertLsCas13a-gRNA-2
UseCRISPRExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS_KS_attB2_SA(2)_T2AGeneSwitch
Plasmid#125216PurposeArtificial phase 2 exon to include a spliced T2A-GeneSwitch effector into a locus of interest through RMCE of MiMIC insertion in an intron between coding exons of a geneDepositorInsertGeneSwitch
UseOtherTagsT2AAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBS_KS_attB2_SA(2)_T2AGAL80
Plasmid#125219PurposeArtificial phase 2 exon to include a spliced T2A-GAL80 effector into a locus of interest through RMCE of MiMIC insertion in an intron between coding exons of a geneDepositorInsertGAL80
UseOtherTagsT2AAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
HM110 prp16-2
Plasmid#111277Purposeprp16-2 in pSE358(Trp)DepositorInsertPRP16
ExpressionYeastMutationprp-2 (D575N)Available SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYU-2-Env
Plasmid#133997PurposeEnv gene from HIV-1 YU-2 in pcDNA3.1 expression vectorDepositorInsertEnvelope Glycoprotein
ExpressionMammalianPromoterCMVAvailable SinceMarch 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-SREBP-2
Plasmid#204200PurposeMammalian expression of SREBP-2DepositorAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCas9-sgAAVS1-2
Plasmid#129727PurposeExpressing SpCas9 and sgAAVS1-2DepositorInsertSpCas9 and sgAAVS1-2
UseCRISPRTagsT2A-mCherry-P2A-PuroExpressionMammalianPromoterhU6Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shBRCA1 #2
Plasmid#44595DepositorAvailable SinceMay 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
RUBY-ABE#2
Plasmid#232176PurposeT-DNA vector with ecTadA8e-zCas9D10A and corresponding sgRNA to correct RUBYm2 and recover a vivid red color visible to the naked eyes.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-sgRNA-mis4-gRNA scaffold
UseCRISPRTags3xflag and NLSExpressionPlantAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only