We narrowed to 9,452 results for: tre promoter
-
Plasmid#69814PurposeExpresses M2-SH3PXD2A in mammalian cellsDepositorInsertSH3 and PX domain-containing protein 2A (SH3PXD2A Human)
TagsFLAGExpressionMammalianPromoterSV40 early promoterAvailable SinceMay 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
gRNA[Sxl].1026B
Plasmid#112688Purposeexpress gRNA targeting Sxl under dU6-3 promoterDepositorInsertU6.3-gRNA[Sxl] (Sxl Fly)
UseCRISPRAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBT3102
Plasmid#122548PurposeExpression of a C. elegan codon optimized florescent protein (CemOrange2) fused to a plasma membrane localized gene (aqp-1) under the intestinal specific promoter nhx-2DepositorAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBT2999
Plasmid#122535PurposeExpression of a C. elegan codon optimized fluorescent protein (CemOrange2) fused to a lysosome localized gene (lmp-1) under the intestinal specific promoter nhx-2DepositorAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmMextli
Plasmid#79262PurposeExpresses EGFP-tagged DmMextli in S2 cellsDepositorInsertDmMextli (mxt Fly, NM_164598)
UseSchneider 2 cell expressionTagsEGFPPromoterAc5 promoterAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-H2B-HaloTag-FRT
Plasmid#247338PurposeExpresses H2B-Halo under EF1 promoter and can be integrated into FRT siteDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
phSyn2 sfGFP-RNF152
Plasmid#215374PurposeLentiviral expression of sfGFP-tagged lysosome membrane protein RNF152 under the neuron-specific human synapsin promoter.DepositorInsertRNF152 (RNF152 Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
mC4-GFP
Plasmid#221339PurposeExpresses murine homolog of complement 4 fused with GFP under CAG promoterDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eA3A-BE5-(NG)-PX458-EGFP
Plasmid#229687PurposeCRISPR CBE plasmid (C to T edits): eA3A-BE5-NG engineered to include the sgRNA cloning backbone from PX458 and EGFP. Includes BbsI sites for sgRNA cloning downstream of U6 promoter.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianAvailable SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pCAG-RhoA*
Plasmid#198716PurposeExpresses gRNA resistant RhoA under the CAG promoter in mammalian cellsDepositorInsertRhoA (Rhoa Mouse)
ExpressionMammalianMutationIt has mutations that is resistant to the RhoA gR…PromoterCAGAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSG086
Plasmid#214263PurposePaFtsH2H1-link-32-6xHis: PaftsH2(ftsH2_F124-V154del_ins ftsH1_M120-T151)-6xHis cloned in XbaI/NheI site in pET-28a(+)DepositorInsertHybrid PaFtsH protease PaFtsH2H1-link-32 of Pseudomonas aeruginosa SG17M
Tags6x His-tagExpressionBacterialMutationsubstitution of 31 amino acids of FtsH2 (F124RRFA…PromoterT7 promoterAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS7 puro
Plasmid#208405PurposeExpresses FLAG-tagged Drosophila IntS7 from inducible MtnA promoterDepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS13 puro
Plasmid#208406PurposeExpresses FLAG-tagged Drosophila IntS13 from inducible MtnA promoterDepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS14 puro
Plasmid#208407PurposeExpresses FLAG-tagged Drosophila IntS14 from inducible MtnA promoterDepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS6 puro
Plasmid#195076PurposeExpresses FLAG-tagged Drosophila IntS6 from inducible MtnA promoterDepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS12 puro
Plasmid#195077PurposeExpresses FLAG-tagged Drosophila IntS12 from inducible MtnA promoterDepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-BR1-P2A-FusionRed
Plasmid#192819PurposeExpresses BR1 with FusionRed tag in mammalian cellsDepositorInsertBR1 (BRI1 Mustard Weed)
UseAAVTagsFusionRedExpressionMammalianPromoterchicken β-actin promoterAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUBQ10:LYK5_At-3xHA
Plasmid#202192PurposeExpress Arabidopsis thaliana LYK5 gene under UBQ10 promoterDepositorInsertLYSM-CONTAINING RECEPTOR-LIKE KINASE 5 (LYK5 Mustard Weed)
TagsHAExpressionPlantPromoterAtUBQ10Available SinceSept. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
trp1D-proLYS2-GFP-PKCdelta(C1a+C1b)-NAT
Plasmid#184774PurposeMarker for DAG. Yeast expression of mouse PKCdelta under LSY2 promoter. Uses antibiotic resistance marker natMX6. Replaces endogenous TRP1 upon genome integration, leading to trp1D.DepositorAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV_pMBP-dnVamp3-P2AT2A-EGFP-caax
Plasmid#190154PurposeExpresses dominant-negative Vamp3 (rat Vamp3 AA 1-81) plus membrane-targeted EGFP in oligodendrocytes; AAV vectorDepositorInsertVamp3 (Vamp2 Rat)
UseAAVTagsP2AT2A-EGFP-caaxExpressionMammalianMutationTruncation that includes only rat Vamp3 AA #1-81PromoterMBPAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R4-bpFOG-B5::B1-NLSLacZ-B2
Plasmid#186414PurposeAttR3/R4 destination vector for ascidian electroporation with AttB1/B2 recombined NLSLacZ under control of AttB4/B5-recombined pFOG ectodermal regulatory sequence.DepositorInsertlacZ (lacZ E. coli)
UseGateway destination vectorTagsNuclear localization signalPromoterBasal promoter of the FOG geneAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
MAC-IFITM3
Plasmid#172419PurposeMAC-tagged gene expressionDepositorInsertInterferon-induced transmembrane protein 3 (IFITM3 Human)
TagsMAC-tagExpressionMammalianPromoterCMV promoterAvailable SinceNov. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pQlinkG2-PTPIP51(236-470)
Plasmid#170534PurposeExpresses Cleavable GST-tagged PTPIP51 TPR domain (236-470) in E. ColiDepositorInsertProtein tyrosine phosphatase interacting protein 51 (RMDN3 Human)
TagsGST tagExpressionBacterialPromoterT5 promoterAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQlinkH-PTPIP51(236-470)
Plasmid#170530PurposeExpresses Cleavable His-tagged PTPIP51 TPR domain (236-470) in E. ColiDepositorInsertProtein tyrosine phosphatase interacting protein 51 (236-470) (RMDN3 Human)
TagsHis tagExpressionBacterialPromoterT5 promoterAvailable SinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBW_0005
Plasmid#102837PurposeBinary vector containing Sr22 PI573523 allele driven by maize ubiquitin promoter, Sr22 terminatorDepositorAvailable SinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTripZ-B2
Plasmid#163924PurposeFor making a cell line that expresses doxycyline-inducible RNAi suppressor protein B2 for increasing titer of lentivirus with bidirectional promoters during virus production.DepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E MUT
Plasmid#110122PurposeExpresses Flag-tagged D. melanogaster Hel25E with 4 mutations that impact circRNA nuclear export activityDepositorInsertHel25E (Hel25E Fly)
TagsFlagExpressionInsectMutation4 mutations (KKLN motif changed to RSFS)PromoterMetallothionein Promoter (pMT)Available SinceSept. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-NOS-IN133.3xFLAG-WPRE
Plasmid#127869PurposepAAV plasmid expressing an NOS-IN133.3xFLAG fusion protein under the hSyn promoterDepositorAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBT3038
Plasmid#122545PurposeExpression of a C. elegan codon optimized florescent protein (CemOrange2) fused to a lysosomal related organelle localized gene (glo-1) under the intestinal specific promoter nhx-2DepositorAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBT3043
Plasmid#122546PurposeExpression of a C. elegan codon optimized florescent protein (CemOrange2) fused to a autophagic localized gene that is orthologus to mamalian LC3 (sqst-1) under the intestinal specific promoter nhx-2DepositorAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KG#84
Plasmid#110878PurposeExpresses the C. elegans acy--1 P260S gain-of-function cDNA in ventral cord cholinergic motor neuronsDepositorInsertsunc-17beta promoter
acy-1 P260S gain-of-function cDNA
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
ExpressionBacterialMutationChanged Proline to Serine at amino acid 260Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only