We narrowed to 6,377 results for: cat.2
-
Plasmid#35234DepositorInsertZinc finger array targeting col6a2 (col6a2 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
col6a2_L (OZ593)
Plasmid#35233DepositorInsertZinc finger array targeting col6a2 (col6a2 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Lmnb1 Donor;3xV5 KO;Mecp2
Plasmid#240298PurposeKI:Lmnb1 Donor:3xV5 KO:Mecp2DepositorInsertKI gRNA for Lmnnb1
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
T7-VEE-OKS-iG
Plasmid#58974PurposeRNA-based iPSC generation. VEE RNA replicon 3'ORF encoding OCT4, KLF4, SOX2 separated by 2A peptides followed by an IRES then GLIS1 and a second IRES and PuroR ORFDepositorUseVenezuelan equine encephalitis (vee) virus rna re…ExpressionMammalianAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
HA-SOCS1
Plasmid#174571PurposeHuman HA-tagged SOCS1 expression (N-term. tag) (CMV prom.)DepositorInsertHA-SOCS1
ExpressionMammalianPromoterCMVAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shSLC2A1-1
Plasmid#193702PurposeConstitutive lentiviral expression of SLC2A1 shRNADepositorInsertSLC2A1 (SLC2A1 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-tagBFP-2A-ICP0-FxE
Plasmid#235539PurposeTo express tagBFP-2A-ICP0-FXE (ICP0 ∆106-149)DepositorInsertICP0-FxE
UseLentiviralMutationDeletion of the RING domain, ∆106-149.Available SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-PHD2
Plasmid#21401DepositorAvailable SinceSept. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAcUW51-gEgIL
Plasmid#11622DepositorInsertHSV-1 glycoprotein E and HSV-1 glycoprotein I
TagsHisExpressionInsectMutationDicistronic vector containing HSV-1 gE (KOS strai…Available SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
iBE3 CLYBL
Plasmid#174569Purposedoxycycline inducible BE3 expression for human CLYBL locus knock-inDepositorInsertBE3
ExpressionMammalianPromotertet ONAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
p-miR-Report + WT miR-181 BS in NLK 3UTR
Plasmid#22790DepositorInsertWild-type miR-181 Binding Site in Nemo-like kinase 3 Untranslated Region (NLK Human)
UseLuciferaseAvailable SinceMarch 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
p-miR-Report + MT miR-181 BS in NLK 3UTR
Plasmid#22791DepositorInsertMutant miR-181 Binding Site in Nemo-like kinase 3 Untranslated Region (NLK Human)
UseLuciferaseAvailable SinceMarch 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-tagBFP-2A-coICP0-∆USP7
Plasmid#235540PurposeTo express tagBFP-2A-coICP0-∆USP7 (ICP0 ∆618-633, co = codon-optimized)DepositorInsertICP0-∆USP7
UseLentiviralMutationDeletion of region ∆618-633.Available SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
SP6-VEE-OKS-iM
Plasmid#58973PurposeRNA-based iPSC generation. VEE RNA replicon 3'ORF encoding OCT4, KLF4, SOX2, separated by 2A peptides followed by an IRES then c-myc and a second IRES and PuroR ORFDepositorUseVenezuelan equine encephalitis (vee) virus rna re…ExpressionMammalianAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
SP6-VEE-OKS-iG
Plasmid#58975PurposeRNA-based iPSC generation. VEE RNA replicon 3'ORF encoding OCT4, KLF4, SOX2 separated by 2A peptides followed by an IRES then GLIS1 and a second IRES and PuroR ORFDepositorUseVenezuelan equine encephalitis (vee) virus rna re…ExpressionMammalianAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
HA-EglN1-pcDNA3
Plasmid#18963DepositorAvailable SinceAug. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
FLAG-JAK1Gly590Arg
Plasmid#174573PurposeHuman FLAG-tagged JAK1 Gly590Arg mutant expression (N-term. tag) (CMV prom.)DepositorInsertJAK1Gly590Arg
TagsFLAGExpressionMammalianMutationGly590ArgPromoterCMVAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-GMIP(trunc C2)
Plasmid#221280PurposeExpression of GMIP C-terminal truncation 2 (1-44) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only