We narrowed to 5,380 results for: Mos;
-
Plasmid#217797PurposeVariant CE1 construct with Cdc13(Y556A) telomere binding protein for template recruitment, expressed from CMV or T7 promoters.DepositorInsertCdc13(Y556A)-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationCdc13(Y556A); nSpCas9(H840A); EcKlenow(-exo;D355A…PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-4gRNA-GBX2-RFP
Plasmid#192288PurposeExpresses RFP and four sgRNAs against GBX2DepositorAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1-U6-sgCas9
Plasmid#190903PurposeAAV-KamiCas9 vector expressing expressing thew GFP reporter gene and sgHTT and sgCas9DepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 186-199 L188A/L192A
Plasmid#108288PurposeExpresses residues 186-199 with L to A mutations at residues 188 and 192 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-286DepositorInsertCHMP1B (CHMP1B Human)
TagsGSTExpressionBacterialMutationchanged L 188 to A, changed L 192 to AAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 186-199 L192A/L195A
Plasmid#108290PurposeExpresses residues 186-199 with L to A mutations at residues 192 and 195 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-287DepositorInsertCHMP1B (CHMP1B Human)
TagsGSTExpressionBacterialMutationchanged L 188 to A, changed L 192 to AAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
CPH3569 (YCp LEU2 Rpb1 P1455_E1456InsGGGGGLEVLFQGP(H)10,K1487N,D1497K; msLink2)
Plasmid#91820PurposeYeast expression of S. cerevisiae Rpb1 with an internal PreScission protease site and 10xHis tag for purification of the linker-CTDDepositorInsertRPO21 (RPO21 Budding Yeast)
Tags10xHisExpressionYeastMutation5xGly linker, PreScission Protease site (LEVLFQGP…PromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-mutated N-terminal (N) O-Glycosylation site
Plasmid#120404Purposeenables eukaryotic expression of human plasma fibronectin in which the first O-glycosylation site was mutated from threonine to serineDepositorInsertFibronectin (FN1 Human)
ExpressionMammalianMutationContaining complete variable region with a mutati…PromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-mutated V2 O-Glycosylation site
Plasmid#120405Purposeenables eukaryotic expression of human plasma fibronectin in which the second O-glycosylation site was mutated from threonine to serineDepositorInsertFibronectin (FN1 Human)
ExpressionMammalianMutationContains complete variable region with a mutation…PromoterCMVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (FL-based no force control)
Plasmid#118722PurposeThe donor (YPet(short)) only control for the no force control of the FL-based human desmoplakin II tension sensor provides the donor only lifetime used in lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-FL-mCherry(Y72L)] (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y72L mutation in mCherry…PromoterCMVAvailable SinceDec. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II acceptor only control (F40-based no force control)
Plasmid#118720PurposeThe acceptor (mCherry) only control for the no force control of the F40-based human desmoplakin II tension sensor can be co-expressed with the donor only control to determine intermolecular FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)(Y67G)-F40-mCherry] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y67G mutation in YPet(sh…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno FT
Plasmid#101824PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3DepositorUseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/T0-Flag-CIP2A
Plasmid#222623Purposemammalian expression vector of Flag-tagged CIP2ADepositorAvailable SinceJuly 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pB-EF1a-FastFUCCI-IRES-3xnls-mTagBFP2 (JDW 1511)
Plasmid#242599PurposeA PiggyBac expression vector containing the human EF1a promoter driving FastFUCCI to label cell cycle state followed by an IRES-3xnls-mTagBFP2.DepositorInsertmKO2-hCDT1(30-120) T2A mAG-hGEM(1-110) (EEF1A1 Human)
ExpressionMammalianPromoterhuman EF1aAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-Flag-SPRTN-wt
Plasmid#110214PurposeExpression in mammalian cells of full-length wild-type SPRTN protein with a Flag-tag at N-terminus.DepositorAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZB246-T7-T+
Plasmid#250903PurposeExpresses N-terminal His-tag thermally stabilized T7 RNAP under a lac-inducible promoter on Kanamycin Resistance BackboneDepositorInsertThermally Stable T7 RNA Polymerase
Tags6xHisExpressionBacterialMutationArginine 31 to Aspartic Acid, Alanine 61 to Argin…PromoterpT5-lacUVAvailable SinceFeb. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHIV-NAT-FLAG-CIP2A FL (sg2R)
Plasmid#222624PurposeLentiviral vector that expresses Flag-tagged sgRNA resistant CIP2A in mammalian cellsDepositorInsertCIP2A (CIP2A Human)
UseLentiviralTagsFlagExpressionMammalianPromoterEF-1-alpha promoterAvailable SinceJuly 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
PIG-MycT58A
Plasmid#177648PurposeExpression of mouse Myc with T58A point mutationDepositorInsertMyc-T58A (Myc Mouse)
UseRetroviralTagsGFP and IRESExpressionMammalianMutationT58A point mutationAvailable SinceFeb. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCag SE (Self-excising) FlpO-2A-Cre EV
Plasmid#130986Purposeepisomal expression of FlpO and Cre recombinases, self excisingDepositorInsertFlpO-2A-Cre
UseCre/Lox and Unspecified; Episomal expression vect…ExpressionMammalianMutationprotamine intron added to FlpO to prevent bacteri…PromoterCMV/Chick β-actin (CAG)Available SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TAF15 Stop
Plasmid#84895PurposeDONOR vector for Gateway cloning of TAF15DepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only