We narrowed to 23,297 results for: promoter
-
Plasmid#61358Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inactivating mutation D1399Y) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Synthetic, Human, S. pyogenes)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; D1399Y mutation i…PromoterCMVAvailable sinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
TOPO-HIF1A
Plasmid#226452PurposeFor subcloning of human HIF1A promoter or for assays using M13 phageDepositorInsertHIF1A (HIF1A Human)
UseCloning vectorTagsExpressionMutationNoPromoterAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGGG-AH-VRT-A2
Plasmid#163703PurposeWheat transformation vector pGoldenGreenGate (pGGG) with OsActinP:: hygromycin (hpt) selection and the full native Triticum polonicum VRT-A2 gene (native prom::genomic seq::3'UTR)DepositorInsertsOs Actin promoter :: Hygromycin resistance gene (hpt) containing CAT1 intron :: NosTerminator
Triticum polonicum VRT-A2 genomic sequence (Native promoter:: genomic sequence::3'UTR) + Nos Terminator
UseTagsExpressionPlantMutationPromoterRice - Os Actin promoter and Triticum polonicum V…Available sinceJan. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (Y1467F)
Plasmid#61362Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inavtivating mutation Y1467F) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Synthetic, Human, S. pyogenes)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; Y1467F mutation i…PromoterCMVAvailable sinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-KIF5A-HA-IRES-Puro
Plasmid#166952PurposeLentiviral plasmid expressing HA-tagged KIF5A protein with IRES-Puro from the EF1a promoterDepositorInsertKIF5A (Kif5a Mouse)
UseLentiviralTagsHAExpressionMutationPromotereF1aAvailable sinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
UseTagsExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1557 to-1046)
Plasmid#226446PurposeFor subcloning of human EXOC3 promoter (base pairs -1557 to-1046) or for assays using M13 phageDepositorInsertEXOC3 (-1557 to-1046) (EXOC3 Human)
UseCloning vectorTagsExpressionMutationNoPromoterAvailable sinceSept. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-2455 to -1951)
Plasmid#226441PurposeFor subcloning of human EXOC3 promoter (base pairs -2455 to -1951) or for assays using M13 phageDepositorInsertEXOC3 (-2455 to -1951) (EXOC3 Human)
UseCloning vectorTagsExpressionMutationNoPromoterAvailable sinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1592 to -1046)
Plasmid#226444PurposeFor subcloning of human EXOC3 promoter (base pairs -1592 to -1046) or for assays using M13 phageDepositorInsertEXOC3 (-1592 to -1046) (EXOC3 Human)
UseCloning vectorTagsExpressionMutationNoPromoterAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1591 to -1009)
Plasmid#226443PurposeFor subcloning of human EXOC3 promoter (base pairs -1591 to -1009) or for assays using M13 phageDepositorInsertEXOC3 (-1591 to -1009) (EXOC3 Human)
UseCloning vectorTagsExpressionMutationNoPromoterAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1701 to -1594)
Plasmid#226442PurposeFor subcloning of human EXOC3 promoter (base pairs -1701 to -1594) or for assays using M13 phageDepositorInsertEXOC3 (-1701 to -1594) (EXOC3 Human)
UseCloning vectorTagsExpressionMutationNoPromoterAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1592 to -1444)
Plasmid#226445PurposeFor subcloning of human EXOC3 promoter (base pairs -1592 to -1444) or for assays using M13 phageDepositorInsertEXOC3 (-1592 to -1444) (EXOC3 Human)
UseCloning vectorTagsExpressionMutationNoPromoterAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1557 to-1444)
Plasmid#226447PurposeFor subcloning of human EXOC3 promoter (base pairs -1557 to-1444) or for assays using M13 phageDepositorInsertEXOC3 (-1557 to-1444) (EXOC3 Human)
UseCloning vectorTagsExpressionMutationNoPromoterAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBC001 v3
Plasmid#161711PurposeCMVp-EGFP-[barcode cloning site]-PGKp-Puro-WPREDepositorTypeEmpty backboneUseLentiviral and Synthetic BiologyTagsExpressionMammalianMutationPromoterCMV PromoterAvailable sinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1219
Plasmid#228301Purpose2,4-Diacetylphloroglucinol (DAPG)-regulatable expression of SARS-CoV-2 RBD omicron variantDepositorInsertMFalpha(2xAdv)-SARS CoV-2 receptor binding domain (RBD)-His (S Synthetic, Severe acute respiratory syndrome-related coronavirus 2)
UseSynthetic BiologyTagsGGG linker followed by His6 and MF_ secretion sig…ExpressionYeastMutationG339D, S371L, S373P, S375F, K417N, N440K, G446S, …Promoter2,4-Diacetylphloroglucinol-regulatable synthetic …Available sinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
PGL4.11-COL1A1mTEAD
Plasmid#230916PurposeComparing with wild type COL1A1 promoter, tested whether mutant TEAD binding sites changed the promoter activity.DepositorInsertHuman COL1A1 promoter with mutant TEAD elements (COL1A1 Human)
UseLuciferaseTagsLuciferase- luc2pExpressionBacterial and MammalianMutationmutant potential TEAD bind elements AGGAAT to CTG…PromoterCOL1A1Available sinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-KIF5AR280H-HA-IRES-Puro
Plasmid#166953PurposeLentiviral plasmid expressing HA-tagged KIF5A R280H protein with IRES-Puro from the EF1a promoterDepositorInsertKIF5A-R280H (Kif5a Mouse)
UseLentiviralTagsHAExpressionMutationKIF5A-R280HPromotereF1aAvailable sinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (C1204R)
Plasmid#61361Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; mutation C1204R) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Synthetic, Human, S. pyogenes)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; C1204R mutation i…PromoterCMVAvailable sinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
DH10B-ALT
Bacterial Strain#61151PurposeDH10B modified to constitutively express araC, lacI, and tetR, integrated at the attB site on the E Coli genome. This is DH10B-ALT-Tet with the tetracycline resistance cassette deleted.DepositorBacterial ResistanceNoneAvailable sinceOct. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
AV04
Bacterial Strain#115926PurposeExpression of dCas9 gene under the control of a Ptet promoter in the E. coli chromosomeDepositorBacterial ResistanceNoneAvailable sinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only