We narrowed to 60,538 results for: Gene
-
Plasmid#71971PurposeExpresses the extracellular region of the Neuropilin 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pBSII-PGK-FLPo-IRES-Puro
Plasmid#205989PurposeExpresses Flp recombinase and puromycin resistanceDepositorAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
Sema4c-AP-His
Plasmid#72030PurposeExpresses the extracellular region of the Sema4C protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPL001
Plasmid#184750PurposeBig-IN positive control payload encoding EF1a-driven GFP-T2A-BSD.DepositorInsertpEF1a-eGFP-T2A-BSD-bGHpA
UseCre/Lox, Mouse Targeting, and Synthetic Biology ;…ExpressionMammalianPromoterEF1aAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
E. coli BL21 (DE3) ΔEntD
Bacterial Strain#192874PurposeDeletion of native E. coli EntD, a 4'-PPTase required for native enterobactin synthesis. Allows expression of NRPS carrier proteins that do not harbor a phosphopantetheinyl group.DepositorBacterial ResistanceNoneSpeciesEscherichia coliAvailable SinceSept. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGGG-AH-VRT-A2
Plasmid#163703PurposeWheat transformation vector pGoldenGreenGate (pGGG) with OsActinP:: hygromycin (hpt) selection and the full native Triticum polonicum VRT-A2 gene (native prom::genomic seq::3'UTR)DepositorInsertsOs Actin promoter :: Hygromycin resistance gene (hpt) containing CAT1 intron :: NosTerminator
Triticum polonicum VRT-A2 genomic sequence (Native promoter:: genomic sequence::3'UTR) + Nos Terminator
ExpressionPlantPromoterRice - Os Actin promoter and Triticum polonicum V…Available SinceJan. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(S)-Fc-His
Plasmid#72138PurposeExpresses the Sema3A protein (truncated at cleavage site P1; ie, short), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema4d-AP-His
Plasmid#72031PurposeExpresses the extracellular region of the Sema4D protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCHKU38.2-2.2
Plasmid#110670PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertS_cerevisiae_ADH2-ORF1, S_bayanus_ADH2-ORF2, PCK1-ORF3, MLS1-ORF4, S_paradoxus_ADH2-ORF5, S_kudeiaveseii_ADH2-ORF6, ICL1-ORF7
ExpressionYeastAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCHKU20.1-2.2
Plasmid#115531PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertS_cerevisiae_ADH2-ORF1, S_bayanus_ADH2-ORF2, PCK1-ORF3, MLS1-ORF4, S_paradoxus_ADH2-ORF5, S_kudeiaveseii_ADH2-ORF6
ExpressionYeastAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCHSU68.2-2.2
Plasmid#110681PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertS_cerevisiae_ADH2-ORF1, S_bayanus_ADH2-ORF2, PCK1-ORF3, MLS1-ORF4, S_paradoxus_ADH2-ORF5, S_kudeiaveseii_ADH2-ORF6
ExpressionYeastAvailable SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCHKU33.2-2.2
Plasmid#110667PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertS_cerevisiae_ADH2-ORF1, S_bayanus_ADH2-ORF2, PCK1-ORF3, MLS1-ORF4, S_paradoxus_ADH2-ORF5, S_kudeiaveseii_ADH2-ORF6
ExpressionYeastAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.1-Fc-His
Plasmid#72098PurposeExpresses the extracellular region of the Neuropilin 2, isoform 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
Plxna3-AP-His
Plasmid#71998PurposeExpresses the extracellular region of the PlexinA3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema7a-Fc-His
Plasmid#72175PurposeExpresses the extracellular region of the Sema7A protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMADM-alpha
Plasmid#36890DepositorInsertsGFP
tdTomato-3Myc
beta-globin intron
Neo
ATG (T)
GFP
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, deleted…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP (AAV1)
Viral Prep#117383-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-TRE-DIO-eYFP (#117383). In addition to the viral particles, you will also receive purified pAAV-TRE-DIO-eYFP plasmid DNA. Tet-inducible, Cre-dependent eYFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterTRETagseYFP (Tet-inducible, Cre-dependent)Available SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
mSwAP-In MC2v2 (pKBA135)
Plasmid#254035PurposemSwAP-In payload acceptor vector for delivery of large DNA constructs to mammalian cells. Encodes LEU2 yeast selectable marker and components for bacterial copy number induction.DepositorInsertmNeonGree-P2A-FCU1-T2A-NeoR
UseSynthetic Biology; Mouse targetingExpressionMammalianPromoterhuman EF1aAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(S)-AP-His
Plasmid#72012PurposeExpresses the Sema3A protein (truncated at cleavage site P1; ie, short), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
LEGO-pDHS-AP1x6-DUSP5
Plasmid#217418PurposeLuciferase expression vector with 6 AP-1 sites and the full length DUSP5 promoter, and a chromatin priming element. Alias: LEGO-DUSP5p-AP-1x6DepositorInsertLuciferase, GFP
UseLentiviral and LuciferaseExpressionMammalianPromoterHuman DUSP5 promoterAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Dscam1_7.27.25 EC10-Fc-His
Plasmid#72188PurposeExpresses the 10 N-terminal extracellular domains of the Dscam, isoform 7.27.25 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertDscam1_7.27.25
TagsFc-HisExpressionMammalianPromoterCMVAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
Dscam1_7.27.25 EC10-AP-His
Plasmid#72062PurposeExpresses the 10 N-terminal extracellular domains of the Dscam, isoform 7.27.25 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertDscam1_7.27.25
TagsAP-HisExpressionMammalianPromoterCMVAvailable SinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBT270_(pCA-G-intron(Neo)-tTA2-iiTRE-tdT3Mycii)
Plasmid#36881DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-EYFP (AAV PHP.V1)
Viral Prep#104052-AAVPHP.V1PurposeReady-to-use AAV PHP.V1 particles produced from pAAV-CAG-DIO-EYFP (#104052). In addition to the viral particles, you will also receive purified pAAV-CAG-DIO-EYFP plasmid DNA. CAG-driven, Cre-dependent expression of EYFP. These AAV were produced with the PHP.V1 serotype, which permits efficient transduction of brain vascular cells. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEYFP (Cre-dependent)Available SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
EC71174
Plasmid#154067PurposeLevel 2 Golden Gate vector, pL2M-HvHSP17-CREU5-UBQ-loxmCHERRYER-eGFPERDepositorInsertsHS Cre recombinase
Ubiquitin promoter driving mCherry with the 35S terminator, flanked by lox sites, followed by eGFP with the Actin terminator
HYGROMYCIN Resistance Cassette
UseCre/Lox and Synthetic Biology; Golden gateExpressionBacterial and PlantMutationThe Arabidopsis thaliana U5 small nuclear ribonuc…Promoter35S promoter, Hordeum vulgare HSP 17 promoter use…Available SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
V. natriegens NC7
Bacterial Strain#215356PurposeVibrio natriegens with genomically integrated natural competence regulator, TfoX. For zero-capital molecular biology applications.DepositorBacterial ResistanceNoneAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHSU74.2-2.2
Plasmid#115543PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertS_cerevisiae_ADH2-ORF1, S_bayanus_ADH2-ORF2, PCK1-ORF3, MLS1-ORF4, S_paradoxus_ADH2-ORF5, S_kudeiaveseii_ADH2-ORF6, ICL1-ORF7
ExpressionYeastAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
L1cam-Fc-His
Plasmid#72083PurposeExpresses the extracellular region of the L1CAM protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCellFree_G03 NFKB1
Plasmid#67126PurposeStandard for cell-free expression benchmarking.DepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only