167,601 results
-
Plasmid#240598PurposeOverexpress truncated alpha-Synuclein proteinDepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pRK172 asyn(1-103)
Plasmid#240597PurposeOverexpress truncated alpha-Synuclein proteinDepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK3071
Plasmid#219755PurposeMoClo-compatible Level P vector for improved autonomous bioluminescence in plants encoding kanamycin resistance cassette, mcitHispS, NpgA, nnH3H_v2, nnLuz_v4 and nnCPH.DepositorInsertmcitHispS, NpgA, nnH3H_v2, nnLuz_v4 and nnCPH
ExpressionPlantAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(mito).iATPSnFR2.A95A.A119L.HaloTag
Plasmid#209722PurposeExpresses mitochondrially targeted low affinity ratiometric ATP sensorDepositorInsert(mito).iATPSnFR2.A95A.A119L.HaloTag
UseAAVExpressionMammalianPromoterCAGAvailable SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRLSIN.cPPT.PGK-GFP.WPRE
Plasmid#12252Purpose3rd generation lentiviral backboneDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMarch 27, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-dLight1.3b (AAV9)
Viral Prep#135762-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-syn-dLight1.3b (#135762). In addition to the viral particles, you will also receive purified pAAV-syn-dLight1.3b plasmid DNA. Syn-driven expression of dLight1.3b dopamine sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
lenti dCAS-VP64_Blast (Lentiviral Prep)
Viral Prep#61425-LVPurposeReady-to-use Lentiviral Prep particles produced from lenti dCAS-VP64_Blast (#61425). In addition to the viral particles, you will also receive purified lenti dCAS-VP64_Blast plasmid DNA.DepositorPromoterEF1aAvailable SinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 (AAV PHP.eB)
Viral Prep#105540-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 (#105540). In addition to the viral particles, you will also receive purified pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 plasmid DNA. Expression of EGFP-Cre from hSyn promoter. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFPAvailable SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX303-ZIM3-KRAB-dCas9
Plasmid#154472PurposeExpresses ZIM3 KRAB domain fused to the N terminus of dCas9DepositorInsertZIM3 (ZIM3 Synthetic)
UseLentiviralTagsHAExpressionMammalianMutationIncludes ZIM3 aa 1-100Available SinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only