We narrowed to 4,684 results for: ARA-2
-
Plasmid#188127PurposeExpresses C-terminal flag-tagged human CAD G1412A in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD R1398A
Plasmid#188131PurposeExpresses C-terminal flag-tagged human CAD R1398A in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD R1403A
Plasmid#188132PurposeExpresses C-terminal flag-tagged human CAD R1403A in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD R1404A
Plasmid#188133PurposeExpresses C-terminal flag-tagged human CAD R1404A in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD S1345A
Plasmid#188119PurposeExpresses C-terminal flag-tagged human CAD S1345A in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD T1348A
Plasmid#188120PurposeExpresses C-terminal flag-tagged human CAD T1348A in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHelper-CBE-sgRNA
Plasmid#221137PurposeHelper plasmid for sgRNA cloning for CRISPR-Cas9 cytosine base editing. sgRNA-scaffold with Cas9 handle expressed from constitutive bacterial promoter J23119(SpeI). 2 BbsI sites for sgRNA cloning.DepositorInsertsgRNA-scaffold with Cas9 handle
UseCRISPRExpressionBacterialPromoterJ23119(SpeI)Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-24p3/LCN2-Luc
Plasmid#25463DepositorAvailable SinceJune 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
-
pNB-Rep
Plasmid#238996PurposeNode B carrying the sfGPF reporter that can be used for the assembly of pEND-11Y, pEND-Y11, pEND-Z11 or pEND-ZYDepositorInsertsfGFP-MarAn10 downstream of a strong constitutive promoter and a binding site for sgRNA-1
UseSynthetic BiologyExpressionBacterialMutationWTAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
JDW 1060 (pME_V5_FOXF2_P2A_H2A_mCherry)
Plasmid#232131PurposeA middle entry gateway clone containing V5 tagged human FOXF2 and an H2A tagged mCherry, separated by a P2A peptide cleavage sequence.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_HLA-cmyc-GRM3 C127A TMD L624N
Plasmid#140455PurposeMammalian expression plasmid for c-myc-tagged mGluR3 C127A and L624N mutantDepositorInsertGRM3 (GRM3 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationCysteine 127 to alanine, leucine 624 to asparagineAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_HLA-cmyc-GRM3 C127A TMD A634N
Plasmid#140456PurposeMammalian expression plasmid for c-myc-tagged mGluR3 C127A and A634N mutantDepositorInsertGRM3 (GRM3 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationCysteine 127 to alanine, alanine 634 to asparagineAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ACE2 receptor 19-615
Plasmid#167012PurposeGateway-compatible Entry vector encoding ACE2 receptor (aa19-615) interacting with spike (S1) RBD domain from SARS-CoV-2DepositorAvailable SinceMarch 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
LV-AR-R599A-N600A
Plasmid#171221PurposeLenti-viral expression of human androgen receptor DNA-binding mutant: R599A-N600A, mutations in the D-box of the Zinc finger 2 that mediates AR dimerization.DepositorInsertAR-R599A-N600A (AR Human)
UseLentiviralTagsFlagExpressionMammalianMutationAR-R599A-N600APromoterEF-1aAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
mEos3.2GG
Plasmid#203756PurposeEncodes a modified version of the membrane anchor of KRas, including the last 16 residues of the C terminus, with mEos3.2 fused to the N terminus. The base pairs encoding the CAAX box for KRas were replaced by the CAAX box from rap1B, resulting in a geranylgeranylation instead of farnesylation. Used as a fluorescent plasma membrane probe.DepositorAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-tetO-hNIL
Plasmid#197089PurposePiggyBac plasmid with tet-inducible expression of transcription factors for motor neuron differentiationDepositorAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSiMPlc_N + pSiMPlc_C
Plasmid#134312PurposeMaintenance of 2 plasmids with a single antibiotic in E. coliDepositorInsertcmR_gp41-1 N-intein + cmR_gp41-1 C-intein
ExpressionBacterialAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBAD-GINKO1
Plasmid#113111PurposeBacterial expression of genetically encoded green fluorescent potassium ion indicator GINKO1DepositorInsertGINKO1
Tags6-His Tag, T7 tag (gene 10 leader), and Xpress™ t…ExpressionBacterialPromoteraraBADAvailable SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only