We narrowed to 14,561 results for: cas9 genes
-
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHS484_10xHis_MBP_TEV_dSpRY
Plasmid#244832PurposeBacterial expression of catalytically inactive SpRY Cas9 (dSpRY) for protein purificationDepositorInsertdSpRY Cas9
UseCRISPRTags10xHis-MBPExpressionBacterialMutationD10A/A61R/H840A/L1111R/D1135L/S1136W/G1218K/E1219…PromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
pSaGuide
Plasmid#64710PurposeCloning and expression of Staphylococcus aureus guide RNADepositorInsertStaphylococcus aureus guide RNA
UseCRISPRExpressionMammalianPromoterhU6Available SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pGMC00018 (aka pRC0082)
Plasmid#195320PurposeMinimal plasmid backbone with multiple cloning site for HDR donor DNA constructionDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionBacterial and MammalianAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pDIV1049
Plasmid#247970PurposeCRISPR-Cas9 vector containing a 20 nt protospacer sequence to target mCitrine. pyrG markerDepositorInsertCas9-AMA1-mCit-gRNA-pyrG-Ori-AmpR
UseCRISPRMutationnoneAvailable SinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_4
Plasmid#192688PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #4
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_1
Plasmid#192685PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #1
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_2
Plasmid#192686PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #2
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_3
Plasmid#192687PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #3
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti sgRNA NGFR CFP out of frame
Plasmid#155283PurposeLentiviral plasmid for sgRNA, NGFR marker, editing detected with CFP, used with 155280DepositorTypeEmpty backboneAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pG1
Plasmid#162602PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pG2
Plasmid#162603PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pG3
Plasmid#162604PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only