We narrowed to 5,579 results for: PEP
-
Plasmid#65700PurposeExpresses CNL-PTS1 in mammalian cellsDepositorInsertperoxisomal targeting signal 1 (tripeptide SKL)
UseLuciferaseTagsCNLExpressionMammalianPromoterCMVAvailable SinceJune 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pONL-C1_PTS1
Plasmid#65701PurposeExpresses ONL-PTS1 in mammalian cellsDepositorInsertperoxisomal targeting signal 1 (tripeptide SKL)
UseLuciferaseTagsONLExpressionMammalianPromoterCMVAvailable SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-20b-T7-Ntx
Plasmid#58714PurposeExpresses T7-Notexin in Escherichia coliDepositorInsertNotexin
TagsT7 peptide tagExpressionBacterialPromoterT7Available SinceAug. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET-Ce25
Plasmid#51296PurposeExpresses a plant arginyl-tRNA synthetase in E.coliDepositorInsertarginyl-tRNA synthetase
TagsHis Tag and ThioredoxinExpressionBacterialMutationGTT (Val) insertion after initiation codon to per…PromoterT7Available SinceJuly 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
PcDNA-DEST53-CypB-Del1 N-term GFP
Plasmid#36131DepositorInsertcyclophilin B (PPIB Human)
TagsGFPExpressionMammalianMutationcontains amino acids 37-216 of cyclophilin B; F21…PromoterCMVAvailable SinceNov. 1, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEG593
Plasmid#40119DepositorInsertMex-5 (ATG through 648 bp of 3'UTR) R274E K318E (RNAi res) (mex-5 Nematode)
UseGateway destination vectorTagsDendra2 PAFP (sequence optimized for worm express…ExpressionWormMutationR274E, K318E, Exon 2 recoded to be RNAi-resistantPromoter4.4 kb mex-5 promoter fragmentAvailable SinceOct. 4, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEG628
Plasmid#40120DepositorInsertMex-5 (aa1-244) (RNAi resistant) (mex-5 Nematode)
UseGateway destination vectorTagsDendra2 PAFP (sequence optimized for worm express…ExpressionWormMutationcontains aa1-244, Exon 2 recoded to be RNAi-resis…Promoter4.4 kb mex-5 promoter fragmentAvailable SinceSept. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBS ADAMTS3
Plasmid#19205DepositorInsertADAM metallopeptidase with thrombospondin type 1 (ADAMTS3 Chicken)
ExpressionBacterialAvailable SinceSept. 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAcUW51-CgE
Plasmid#13762DepositorInsertHSV-1 glycoprotein E
TagsHisExpressionInsectMutationC-terminal region of the HSV-1 gE (KOS strain ect…Available SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn NS34a-msGFP-'S-mito
Plasmid#158768PurposeLentiviral expression of self-cleaving membrane targeting peptide containing the OMP25 C-terminal targeting sequence, the P6P4 NS5A/5B cleavage site, msGFP and the NS3/4A protease.DepositorInsertNS3/4a protease and msGFP
UseLentiviralMutationFlexible linkers between the protease and msGFP a…AvailabilityAcademic Institutions and Nonprofits only -
AAV9retro
Plasmid#224687PurposeAAV packaging plasmid expressing Rep/Cap genesDepositorInsertRep2/Cap9retro
UseAAVMutationinsertion of 10-mer peptide from AAV2retro (LADQD…Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTS117 His14-Avi-45xGS-anti GFP nanobody
Plasmid#199370PurposeBacterial expression plasmid for anti-GFP nanobody with an N-terminal His-tag and biotin acceptor peptide (Avi)DepositorInsertanti-GFP nanobody
Tags14xHis-AviExpressionBacterialMutationWTPromoterT5-LacOAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
anti-FLAG M2 heavy chain
Plasmid#175359PurposeMammalian expression vector for over-expression of anti-FLAG M2 heavy chain (C-terminal His8)DepositorInsertanti-FLAG M2 heavy chain
TagsHis8 tag and N-terminal secretion signal peptide …ExpressionMammalianMutationL51I (see paper)PromoterCMVAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
AIO-Puro
Plasmid#74630PurposeAll-in-One plasmid encoding dual U6 promoter-driven sgRNAs and Cas9-D10A nickase linked via 2A peptide with puromycin resistant marker to enhance efficient and accurate genome editingDepositorTypeEmpty backboneUseCRISPRTagsPuromycin resistant markerExpressionMammalianPromoterCbhAvailable SinceMay 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SpyDock
Plasmid#124618PurposeExpresses SpyDock to bind SpyTag non-covalently for affinity purificationDepositorInsertSpyDock
TagsHis6ExpressionBacterialMutationE77A mutation prevents isopeptide bond formation,…PromoterT7Available SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEX-CMV-SP-YFP-STM2(15-746)
Plasmid#18862DepositorInsertStromal interaction molecule 2 (STIM2 Human)
TagsYFPExpressionMammalianMutationYFP inserted between signal peptide(SP) of STIM1 …Available SinceMarch 24, 2009AvailabilityAcademic Institutions and Nonprofits only -
8522-M01-663
Plasmid#225660PurposeLentiviral expression of a cancer stem cell reporter that responds to presence of Sox2/Oct4 or their paralogs (green configuration)DepositorInsertdsCopGFP
UseLentiviralPromoterSORE6-mCMVpAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLM-CMV-R-Cre
Plasmid#27546PurposeLentiviral bicistronic co-expression of Cre and mCherry; linked by a P2A peptide.DepositorInsertmCherry_P2A_Cre recombinase
UseCre/Lox and LentiviralPromoterCMVAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
MTNR1B-DuET
Plasmid#213349PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only