We narrowed to 4,483 results for: ARA-2
-
Plasmid#160976PurposeExpresses a human myelin oligodendrocyte glycoprotein isoform alpha2 - EGFP fusion protein in mammalian cellsDepositorInsertHomo sapiens myelin oligodendrocyte glycoprotein (MOG), transcript variant alpha2 (MOG Human)
UseTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (AAV9)
Viral Prep#100054-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (#100054). In addition to the viral particles, you will also receive purified pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 plasmid DNA. CAG-driven, humanized channelrhodopsin H134R mutant fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsmCherryAvailable sinceFeb. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (AAV1)
Viral Prep#100054-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (#100054). In addition to the viral particles, you will also receive purified pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 plasmid DNA. CAG-driven, humanized channelrhodopsin H134R mutant fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsmCherryAvailable sinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (AAV2)
Viral Prep#100054-AAV2PurposeReady-to-use AAV2 particles produced from pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (#100054). In addition to the viral particles, you will also receive purified pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 plasmid DNA. CAG-driven, humanized channelrhodopsin H134R mutant fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsmCherryAvailable sinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (AAV5)
Viral Prep#100054-AAV5PurposeReady-to-use AAV5 particles produced from pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (#100054). In addition to the viral particles, you will also receive purified pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 plasmid DNA. CAG-driven, humanized channelrhodopsin H134R mutant fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsmCherryAvailable sinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 hMOG-beta2-EGFP
Plasmid#160979PurposeExpresses a human myelin oligodendrocyte glycoprotein isoform beta2 - EGFP fusion protein in mammalian cellsDepositorInsertHomo sapiens myelin oligodendrocyte glycoprotein (MOG), transcript variant beta2 (MOG Human)
UseTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 3xFlag
Plasmid#110063PurposeFGFR2 expression in mammalian cells (JCOPCO paper)DepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
UseTagsFlagExpressionMammalianMutationnonePromoterCMVAvailable sinceDec. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 F276C 3xFlag
Plasmid#110064PurposeFGFR2 F276C expression in mammalian cells (JCOPO paper)DepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
UseTagsFlagExpressionMammalianMutationmutated Phenylalanine 276 to Cysteine (F276C)PromoterCMVAvailable sinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 K41E 3xFlag
Plasmid#110105Purposeexpresses FGFR2 with a single amino acid change in mammalian cellsDepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
UseTagsFlagExpressionMammalianMutationmutated Lysine 41 to Glutamic acid (K41E)PromoterCMVAvailable sinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-TO-hNGN2
Plasmid#172115PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into glutamatergic neurons via NGN2 expressionInsertsUseTagsT2A-mycNLS-mTagBFP2ExpressionMammalianMutationPromoterEF1a and TRE3GAvailable sinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKT-IDH1(R132H)-IRES-Katushka
Plasmid#124257PurposeExpresses IDH1 with a R132H mutation and katushka fluorescent reporter. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertIsocitrate dehydrogenase 1 (R132H) (IDH1 Human)
UseTagsExpressionMammalianMutationArginine 132 is mutated to Histidine. This mutatiā¦PromoterAvailable sinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
Antibody#180085-rAbPurposeAnti-Arl13b (Mouse) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunohistochemistry and Western BlotReactivityMouse and RatSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable sinceMarch 30, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits
-
PB-TO-hNIL
Plasmid#172113PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into lower motor neurons via NGN2, ISL1, and LHX3 expressionUseTagsT2A-mycNLS-mTagBFP2ExpressionMammalianMutationPromoterEF1a and TRE3GAvailable sinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (AAV5)
Viral Prep#20297-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (#20297). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA plasmid DNA. Humanized channelrhodopsin H134R mutant fused to mCherry, driven by the EF1a promoter. Cre-dependent. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-dependent)Available sinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (AAV9)
Viral Prep#20297-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (#20297). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA plasmid DNA. Humanized channelrhodopsin H134R mutant fused to mCherry, driven by the EF1a promoter. Cre-dependent. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-dependent)Available sinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (AAV1)
Viral Prep#20297-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (#20297). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA plasmid DNA. Humanized channelrhodopsin H134R mutant fused to mCherry, driven by the EF1a promoter. Cre-dependent. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-dependent)Available sinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (AAV8)
Viral Prep#20297-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (#20297). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA plasmid DNA. Humanized channelrhodopsin H134R mutant fused to mCherry, driven by the EF1a promoter. Cre-dependent. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-dependent)Available sinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pACAGW-ChR2-Venus-AAV (AAV1)
Viral Prep#20071-AAV1PurposeReady-to-use AAV1 particles produced from pACAGW-ChR2-Venus-AAV (#20071). In addition to the viral particles, you will also receive purified pACAGW-ChR2-Venus-AAV plasmid DNA. CAG-driven, channelrhodopsin fused to Venus for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGGTagsVenusAvailable sinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pACAGW-ChR2-Venus-AAV (AAV9)
Viral Prep#20071-AAV9PurposeReady-to-use AAV9 particles produced from pACAGW-ChR2-Venus-AAV (#20071). In addition to the viral particles, you will also receive purified pACAGW-ChR2-Venus-AAV plasmid DNA. CAG-driven, channelrhodopsin fused to Venus for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGGTagsVenusAvailable sinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only