We narrowed to 36,622 results for: promoter
-
Plasmid#117056PurposeOverexpression of miR-142-3p using miR-451 backbone to enable DICER-independent expression along with orange fluorescent protein (OFP) to track miRNA expressionDepositorAvailable SinceOct. 4, 2018AvailabilityAcademic Institutions and Nonprofits only
-
UbC-Halo-SFPQ
Plasmid#166946PurposeLentiviral plasmid expressing Halo-tagged SFPQ protein from the UbC promoterDepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-hSncg-EGFP
Plasmid#153198PurposeHuman gamma-synuclein (hSncg) promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
LV-LIN28A
Plasmid#117057PurposeOverexpression of mouse LIN28ADepositorAvailable SinceOct. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pETM6-G6-vioABE
Plasmid#73438PurposeProdeoxyviolacein pathway (vioABE) in monocistronic configuration, transcriptionally driven by orthogonal T7-lac promoter variant G6.DepositorInsertPG6-vioABE
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPG6 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-0.27kb-EGFP
Plasmid#153185PurposeTruncated mouse gamma-synuclein (mSncg-0.27kb) promoter-mediates gene expression in retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmIL-6 mut NF-kB
Plasmid#61293Purposedrives luciferase from mouse IL-6 promoter with mutation in NF-kB siteDepositorInsertIL-6 promoter (Il6 Mouse)
UseLuciferaseExpressionMammalianMutationMutated NF-kB binding site from GTGGGATTTTCCCA to…PromoterIL-6 promoter with mutant NF-kB binding siteAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRaGE Pyl TAG GFP Y35TAG
Plasmid#160041PurposeEncodes for MmPyl tRNA synthetase/tRNA pair and for GFP reporter with TAG mutation at site 35, for unnatural amino acid incorporation into the GFP protein in Vibrio natriegens.DepositorInsertsPyrrolysyl tRNA synthetase (Methanosarcina mazei)
Pyrrolysyl tRNA(cua) (Methanosarcina mazei)
deGFP
UseSynthetic BiologyTagsHis-tagExpressionBacterialMutationChanged tyrosine 35 to TAG stop-codon (Site numbe…PromoterP70b promoter and T500 terminator, Vibrio natrieg…Available SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-UDP1.0-IRES-mCherry-CAAX
Plasmid#220850PurposeCMV promoter drives the expression of an extracellular UDP sensor (UDP1.0) and a membrane localized mCherryDepositorInsertUDP1.0
ExpressionMammalianPromoterCMVAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
BII-BCA-Prom-ASCL2
Plasmid#133394PurposePiggybac vector for heterologous promoter reporter assay of human ASCL2 promoterDepositorInsertdestabilized tdTomato-NLS and destabilized NLS-GFP
ExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free) drives expressi…Available SinceJan. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-EF1.Pro
Plasmid#79488PurposeMultiSite Gateway entry clones, first fragment, (attL1, attR5) Human EF1 promoterDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFIN-RK-GFP-WPRE
Plasmid#44358DepositorInsertRK-GFP (MAPK14 Human, Synthetic)
UseLentiviralPromoterhuman rhodopsin kinase (pos 2557-2853)Available SinceMay 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins2
Plasmid#195039PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYI2165
Plasmid#228347Purpose2,4-Diacetylphloroglucinol (DAPG)-regulatable ALX-0171 expressionDepositorInsertMFalpha(2xAdv)-LE-ALX-0171-3A-FLAG-His
UseAffinity Reagent/ AntibodyTagsAAA linker followed by FLAG-His6 and MF_ secretio…ExpressionYeastPromoter2,4-Diacetylphloroglucinol-regulatable synthetic …Available SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
natMX6-ins5
Plasmid#195042PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertNatR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CIP2Aprom108bp-pGL4.10Luc
Plasmid#60875PurposeLuc reporter driven by 108 bp of the CIP2A promoterDepositorInsertNM_020890108 bp promoter fragment of Cancerous Inhibitor of PP2A.2 (CIP2A Human)
UseLuciferase; PromoterlessAvailable SinceApril 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAuroraA GFP-AURKA-GFP
Plasmid#157765PurposeExpression of AURKA fused to GFP at both ends in mammalian cells under AurkA promoterDepositorInsertAURKA (AURKA Human)
TagsGFPExpressionMammalianMutationpromoter CMV replaced by AurkA promoterPromoterAURKA minimalAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmIL-6 mut C/EBP
Plasmid#61291Purposedrives luciferase from mouse IL-6 promoter with mutant C/EBP (NF-IL-6) siteDepositorInsertIL-6 promoter (Il6 Mouse)
UseLuciferaseExpressionMammalianMutationMutated C/EBP binding site from ACATTGTGCAATCT to…PromoterIL-6 promoter with mutant C/EBP binding siteAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSyn1-EGFP
Plasmid#153187PurposeMouse synapsin-1 (mSyn1) promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only