We narrowed to 14,326 results for: cas9 genes
-
Plasmid#68709PurposeExpresses tdTomato in pTREX-b vector which confers resistance to blasticidin. This vector is used for cloning a specific sgRNA by BamHI, to transfect Cas9-expressing Trypanosoma cruzi epimastigotes.DepositorInserttdTomato
UseExpression of tdtomato red fluorescence protein i…Available SinceOct. 8, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAGM65881
Plasmid#153215PurposeLevel 2 cloning vector for one or several guide RNAs, already contains Cas9 and a kanamycin selection cassette for plant transformationDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAGM55273
Plasmid#153211PurposeLevel 2 cloning vector for a single guide RNA, already contains Cas9, Kanamycin selection cassette for plant transformation and FAST markerDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo
Plasmid#80766PurposeCustomizable donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorTypeEmpty backboneUseCRISPRTagsTagBFP2-3×NLSExpressionMammalianAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLC133
Plasmid#198639PurposeExpression plasmid for dCas9 in E. coli used in Chip-seq experiments. dCas9 is tagged with a C-terminal 3x FLAG tag. A guide RNA can be cloned using BsaI restriction sites.DepositorInsertdCas9
Tags3x-FLAGExpressionBacterialPromoterpTetAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRB14
Plasmid#52522Purposeexpresses a myc-tagged version of hCas9 in DrosophilaDepositorInsertS. pyogenes cas9 with humanized codon bias
TagsmycExpressionInsectPromotertubulinAvailable SinceApril 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAGM55297
Plasmid#153213PurposeLevel 2 cloning vector for a single guide RNA, already contains Cas9, Kanamycin selection cassette for plant transformation and FAST markerDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAGM65905
Plasmid#153217PurposeLevel 2 cloning vector for one or several guide RNAs, already contains Cas9 and a kanamycin selection cassette for plant transformationDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
YE1-BE4max
Plasmid#138155PurposeC-to-T base editorDepositorInsertrAPOBEC1(YE1)-nSpCas9-UGI-UGI
TagsNLSExpressionMammalianMutationWithin rAPOBEC1 W90Y + R126E; within Cas9 D10APromoterCMVAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDIV270
Plasmid#226181PurposeExpresses Cas9 and gRNA targeting KU70 gene in K. phaffii.DepositorInserttRNA-sgRNA-tRNA
UseCRISPRExpressionBacterial and YeastPromoterTEF1p (Komagataella phaffii)Available SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
YEE-BE4max
Plasmid#138157PurposeC-to-T base editorDepositorInsertrAPOBEC1(YEE)-nSpCas9-UGI-UGI
TagsNLSExpressionMammalianMutationWithin rAPOBEC1 W90Y + R126E + R132E; within Cas9…PromoterCMVAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
AALN-BE4max
Plasmid#138161PurposeC-to-T base editorDepositorInsertrAPOBEC1(AALN)-nSpCas9-UGI-UGI
TagsNLSExpressionMammalianMutationWithin rAPOBEC1 R33A + K34A + H122L + D124N; with…PromoterCMVAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
YE2-BE4max
Plasmid#138156PurposeC-to-T base editorDepositorInsertrAPOBEC1(YE2)-nSpCas9-UGI-UGI
TagsNLSExpressionMammalianMutationWithin rAPOBEC1 W90Y + R132E; within Cas9 D10APromoterCMVAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
TetO-FUW-VdC9BV
Plasmid#62195PurposeExpresses RNA-Guided, Nuclease-Inactive VP64:dCas9-BFP:VP64—VdC9BV—Fusion Protein to Enable Transactivation of Endogenous GenesDepositorInsertVP64dCas9BFPVP64
UseLentiviralTagsTwo VP64s tagged to dCas9 fused to BFPExpressionMammalianMutationD10A H840A (catalytically inactive) Cas9 (dCas9)Available SinceJune 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
YE1-BE4max-CP1028
Plasmid#138160PurposeC-to-T base editorDepositorInsertrAPOBEC1(YE1)-nSpCas9 (CP1028) -UGI-UGI
TagsNLSExpressionMammalianMutationWithin rAPOBEC1 W90Y + R126E; within Cas9 (CP1028…PromoterCMVAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
EE-BE4max
Plasmid#138158PurposeC-to-T base editorDepositorInsertrAPOBEC1(EE)-nSpCas9-UGI-UGI
TagsNLSExpressionMammalianMutationWithin rAPOBEC1 R126E + R132E; within Cas9 D10APromoterCMVAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTX209
Plasmid#89269PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01 and OsPDS-gRNA02DepositorInsertOsPDS-gRNA01 and OsPDS-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTX208
Plasmid#89268PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsYSA gene, OsYSA-gRNA01 and OsYSA-gRNA02DepositorInsertOsYSA-gRNA01 and OsYSA-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only