We narrowed to 4,836 results for: HRE
-
Plasmid#83101PurposeLentiviral vector for constitutive expression of human mutant PC5A (T288P) with C-terminal V5 tagDepositorInsertPCSK5 (PCSK5 Human)
UseLentiviralTagsV5ExpressionMammalianMutationChanged Threonine 288 to ProlineAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX304 PCSK5 (A270T)-V5 blast
Plasmid#83102PurposeLentiviral vector for constitutive expression of human mutant PC5A (A270T) with C-terminal V5 tagDepositorInsertPCSK5 (PCSK5 Human)
UseLentiviralTagsV5ExpressionMammalianMutationChanged Alanine 270 to ThreonineAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX302 PCSK5 (T288P)-V5 puro
Plasmid#98709PurposeLentiviral vector for constitutive expression of human mutant PC5A (T288P) with C-terminal V5 tagDepositorInsertPCSK5 (PCSK5 Human)
UseLentiviralTagsV5ExpressionMammalianMutationChanged Threonine 288 to ProlineAvailable SinceAug. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_7x_Bulge
Plasmid#59894Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with seven bulge target sitesDepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--has seven bulge targets (fully comple…Promoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
ppyCAG_RNaseH1_WKKD
Plasmid#111905PurposeExpress WKKD mutated RNASEH1 in mammalian cell. The combination of three specific mutations (W43A, K59A, K60A) in the binding domain prevents the enzyme from binding to RNA/DNA hybridsDepositorInsertRNASEH1 (RNASEH1 Human)
TagsV5ExpressionMammalianMutationChanged D 210 to N, W 43 to A, K 59 to A, K 60 to…Available SinceJuly 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBiFC-SS-VN155(I152L)-IRE1-dLD
Plasmid#217752PurposeExpresses the VN fragment of BiFC-IRE1-dLDDepositorInsertSerine/threonine-protein kinase/endoribonuclease IRE1 (ERN1 Human)
TagsVenus (1-154, I152L)ExpressionMammalianMutationdeleted amino acids 29-408Available SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-3xNLS-mScarlet
Plasmid#191098PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-mScarlet
UseAAV and Synthetic BiologyTagsThree repeats of the nuclear localizzation seque…ExpressionMammalianMutationOptimized to human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMG024 MBP-GSK3β-HA-His, GST_λPPase
Plasmid#196182PurposeCo-expresses MBP-GSK3β-HA-His (human GSK3β as a fusion protein with MBP, HA, and His-tags) and GST_λPPase in E.coli to produce unphosphorylated MBP-GSK3β-HA-HisDepositorAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
p5E-gfap
Plasmid#75024PurposeCan be used to drive expression in zebrafish astrocytes.DepositorInsertglial fibrillary acidic protein promoter (gfap Zebrafish)
Use5' entry vector for multisite gateway three …PromotergfapAvailable SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pInducer20 ALPK1 T237M
Plasmid#231586PurposeALPK1 gene mutated in position T237M (Pathogenic mutation in ROSAH syndrome) under control of a doxycycline-inducible promoterDepositorInsertALPK1 (ALPK1 Human)
UseLentiviralTags3X flagExpressionMammalianMutationchanged threonine 237 to MethioninePromoterdoxycyclineAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBridge-tyrosinase.σ2
Plasmid#197415PurposeExpression of 1) GAL4 DNA-binding domain (BD)-tyrosinase cytosolic tail fusion protein, 2) HA epitope and nuclear localization signal (NLS) AP-2 σ2 fusion protein in yeast (yeast three-hybrid assays)DepositorInsertstyrosinase cytosolic tail
AP-2 σ2
TagsGAL4-DNA binding domain fragment, HA tag, and nuc…ExpressionYeastMutationencodes R42G substitution, contains silent substi…PromoterADH1 and MET25Available SinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3-OGDH_wobble
Plasmid#110938PurposeOGDH ORF containing silent wobble mutations insensitive to corresponding shRNAsDepositorInsertOGDH wobble cDNA (OGDH Human)
UseLentiviralMutation15 silent wobble mutations corresponding to three…PromoterSV40Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/hArf6(T27N)-HA
Plasmid#79426PurposeExpresses C-terminally HA-tagged Arf6(T27N) in mammalian cellsDepositorAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
3xflag-APEX2-LRRK2
Plasmid#164622PurposeExpresses LRRK2 tagged with APEX2 and 3xFLAGDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-3xNLS-AausFP1
Plasmid#191096PurposeTo express a bright green FP to label eucaryotic cell nuclei. To be used in tissue-clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-AausFP1
UseAAV and Synthetic BiologyTagsThree repeats of the nuclear localizzation seque…ExpressionMammalianMutationOptimized to Human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
RCAS-Flag-BRAFV600E
Plasmid#126615PurposeRetroviral expression of Flag tagged human oncogenic BRAFV600EDepositorAvailable SinceJuly 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTH733-2µ-RLuc/maxCFLuc
Plasmid#40608DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177345PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from Synapsin promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterSynapsinAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC Thr58Ala_P2A_Hygro_Barcode
Plasmid#120513PurposeBarcoded lentiviral vector to express MYC Thr58Ala in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC Thr58Ala (MYC Human)
UseLentiviralMutationPoint mutation changing Threonine to Alanine at a…PromoterEF1aAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only