We narrowed to 4,684 results for: ARA-2
-
Viral Prep#100054-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (#100054). In addition to the viral particles, you will also receive purified pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 plasmid DNA. CAG-driven, humanized channelrhodopsin H134R mutant fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsmCherryAvailable SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (AAV9)
Viral Prep#100054-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (#100054). In addition to the viral particles, you will also receive purified pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 plasmid DNA. CAG-driven, humanized channelrhodopsin H134R mutant fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsmCherryAvailable SinceFeb. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (AAV2)
Viral Prep#100054-AAV2PurposeReady-to-use AAV2 particles produced from pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (#100054). In addition to the viral particles, you will also receive purified pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 plasmid DNA. CAG-driven, humanized channelrhodopsin H134R mutant fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsmCherryAvailable SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (AAV5)
Viral Prep#100054-AAV5PurposeReady-to-use AAV5 particles produced from pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (#100054). In addition to the viral particles, you will also receive purified pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 plasmid DNA. CAG-driven, humanized channelrhodopsin H134R mutant fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsmCherryAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
Antibody#218108-rAbPurposeAnti-Protein C tag chimeric recombinant antibody with fused mouse variable and rabbit constant domains; binds to EDQVDPRLIDGK sequence.DepositorRecommended ApplicationsWestern BlotReactivityHumanSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceMay 14, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
FGFR2 3xFlag
Plasmid#110063PurposeFGFR2 expression in mammalian cells (JCOPCO paper)DepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationnonePromoterCMVAvailable SinceDec. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 F276C 3xFlag
Plasmid#110064PurposeFGFR2 F276C expression in mammalian cells (JCOPO paper)DepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationmutated Phenylalanine 276 to Cysteine (F276C)PromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 K41E 3xFlag
Plasmid#110105Purposeexpresses FGFR2 with a single amino acid change in mammalian cellsDepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationmutated Lysine 41 to Glutamic acid (K41E)PromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-TO-hNGN2
Plasmid#172115PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into glutamatergic neurons via NGN2 expressionInsertsTagsT2A-mycNLS-mTagBFP2ExpressionMammalianPromoterEF1a and TRE3GAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4f-NGR-WPRE (AAV1)
Viral Prep#234438-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-syn-iGluSnFR4f-NGR-WPRE (#234438). In addition to the viral particles, you will also receive purified pAAV-syn-iGluSnFR4f-NGR-WPRE plasmid DNA. Syn-driven, iGluSnFR4f-NGR sensor expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4s-NGR-WPRE (AAV1)
Viral Prep#234437-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-syn-iGluSnFR4s-NGR-WPRE (#234437). In addition to the viral particles, you will also receive purified pAAV-syn-iGluSnFR4s-NGR-WPRE plasmid DNA. Syn-driven, iGluSnFR4s-NGR sensor expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKT-IDH1(R132H)-IRES-Katushka
Plasmid#124257PurposeExpresses IDH1 with a R132H mutation and katushka fluorescent reporter. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertIsocitrate dehydrogenase 1 (R132H) (IDH1 Human)
ExpressionMammalianMutationArginine 132 is mutated to Histidine. This mutatiā¦Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-TO-hNIL
Plasmid#172113PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into lower motor neurons via NGN2, ISL1, and LHX3 expressionTagsT2A-mycNLS-mTagBFP2ExpressionMammalianPromoterEF1a and TRE3GAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-flex-iGluSnFR4s-NGR-WPRE (AAV1)
Viral Prep#234441-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-syn-flex-iGluSnFR4s-NGR-WPRE (#234441). In addition to the viral particles, you will also receive purified pAAV-syn-flex-iGluSnFR4s-NGR-WPRE plasmid DNA. Syn-driven, iGluSnFR4s-NGR sensor expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-flex-iGluSnFR4f-NGR-WPRE (AAV1)
Viral Prep#234442-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-syn-flex-iGluSnFR4f-NGR-WPRE (#234442). In addition to the viral particles, you will also receive purified pAAV-syn-flex-iGluSnFR4f-NGR-WPRE plasmid DNA. Syn-driven, iGluSnFR4f-NGR sensor expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
Antibody#201865-rAbPurposeAnti-Desmin (Human) recombinant scFv-Fc-fusionDepositorRecommended ApplicationsELISAReactivityHumanSource SpeciesHumanIsotypeIgG1Trial SizeAvailable to purchaseAvailable SinceOct. 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#241001-rAbPurposeAnti-Glypican 6 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; recognizes human and mouse GPC6. Does not cross-react with other GPCs.DepositorRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceOct. 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#241000-rAbPurposeAnti-Glypican 5 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for human GPC5. Does not cross-react with other GPCs.DepositorRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHumanSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceOct. 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#240999-rAbPurposeAnti-Glypican 4 (Mouse) chimeric recombinant antibody with fused human variable and rabbit constant domains; recognizes mouse and human GPC4. Does not cross-react with other GPCs.DepositorRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceOct. 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits