We narrowed to 5,488 results for: PID;
-
Plasmid#196506PurposeExpresses left-side TALE–DddAtox N term half tl1-FusXTBE in zebrafishDepositorInsertIDH2 MTS-tl1 left TALE-G1397 DddA-C-UGI-SV40 polyA
ExpressionBacterialAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
tl1-FusXTBE-RightTALE
Plasmid#196507PurposeExpresses left-side TALE–DddAtox N term half tl1-FusXTBE in zebrafishDepositorInsertIDH2 MTS-tl1 right TALE-G1397 DddA-C-UGI-SV40 polyA
ExpressionBacterialAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
mKate2-DrCav1 in pT3TS-Dest
Plasmid#194293PurposeIn vitro transcription of mKate2 tagged zebrafish caveolin1 from the T3 promoter. The red fluorescent tag is at the N-terminus. Parton lab clone KZWDepositorInsertcaveolin (cav1.S Frog)
UseIn vitro transcription of mrnaAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
p3E-DrCavin1a
Plasmid#194291PurposeMultisite gateway entry clone for expression of codon optimised zebrafish cavin1a with fusion tag at the N-terminus. Parton lab clone KXMDepositorInsertcavin1a (cavin1a Zebrafish)
UseMultisite gateway entry vectorAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
ABHD2-3'UTR-Del-1
Plasmid#190095Purposeexamine the activity of ABHD2 3'UTRDepositorInsertABHD2 3' UTR delete-1 (ABHD2 Human)
UseLuciferaseExpressionMammalianMutationdeleted the base pairs 6704-6709 refer to NM_0070…Available SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ABHD2-3'UTR-Del-2
Plasmid#190096Purposeexamine the activity of ABHD2 3'UTRDepositorInsertABHD2 3' UTR delete-2 (ABHD2 Human)
UseLuciferaseExpressionMammalianMutationdeleted the base pairs 7122-7129 refer to NM_0070…Available SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmiRFP2-P2A-HO1-N1
Plasmid#178966PurposeExpresses miRFP2 and HO1 in mammalian cellsDepositorInsertmiRFP2-P2A-HO1
TagsnoExpressionMammalianMutationNOPromoterCMVAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX022
Plasmid#167148PurposeMoClo-compatible Level 0-CDS2 promoterless vector encoding C-terminal half of the Neonothopanus nambi hispidin synthase nnHispS codon-optimised for expression in Nicotiana benthamianaDepositorInsertC-part of fungal hispidin synthase, nnHispS
UseSynthetic BiologyAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX021
Plasmid#167147PurposeMoClo-compatible Level 0-SP promoterless vector encoding N-terminal half of the Neonothopanus nambi hispidin synthase nnHispS codon-optimised for expression in Nicotiana benthamianaDepositorInsertN-part of fungal hispidin synthase, nnHispS
UseSynthetic BiologyAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCu-His6-Atg13[571–700] K683E, H685E, K686E-Ss(424)
Plasmid#166855PurposeExpresses 6xHis tagged ATG13 [571–700] fragment mutated in K683E, H685E, K686E with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeastDepositorInsertAtg13[571–700] (ATG13 Budding Yeast)
Tags6xHisExpressionYeastMutationK683E, H685E, K686EPromoterpCuAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCu-His6-Atg13[571–700] F641E, I645E-Ss(424)
Plasmid#166854PurposeExpresses 6xHis tagged ATG13 [571–700] fragment mutated in F641E, I645E with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeastDepositorInsertAtg13[571–700] (ATG13 Budding Yeast)
Tags6xHisExpressionYeastMutationF641E, I645EPromoterpCuAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCu-His6-Atg13[571–700] F641G, I645G-Ss(424)
Plasmid#166853PurposeExpresses 6xHis tagged ATG13 [571–700] fragment mutated in F641G, I645G with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeastDepositorInsertAtg13[571–700] (ATG13 Budding Yeast)
Tags6xHisExpressionYeastMutationF641G, I645GPromoterpCuAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-His6-K2P4.1B-mCherry-StreptagII
Plasmid#158744PurposeExpresses K2P4.1 isoform B with TEV protease cleavable N- and C-terminal affinity tags.DepositorInsertK2P4.1-B (KCNK4 Human)
TagsHis6 and mCherry with Streptag IIExpressionYeastMutationResidues 1-290 and N-linked glycosylation sites r…PromoterAOX1Available SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 Dynamin1 T78R L84R T92R V118R
Plasmid#112106PurposeMammalian expression plasmid of GFP-tagged Dynamin protein.DepositorInsertDynamin1 (DNM1 Human)
TagsEGFPExpressionMammalianMutationT78R L84R T92R V118RPromoterCMVAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMDC32-FIT2-N[80]A
Plasmid#96992PurposeExpress mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
ExpressionPlantMutationAmino acid residue 80 was mutated (N[80]A). Mutat…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTYB-pLAC-L108S/L109S/F112S
Plasmid#48730PurposeBacterial expression of Lacritin Protein with Mutation at proteins 108 and 109 Leucine to Serine and 112 from phenylalanine to serineDepositorInsertLacritin (LACRT Human)
TagsInteinExpressionBacterialMutationLeucine 108 and 109 to Serine; phenylalanine 112 …PromoterT7Available SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
VPS13C^Halo
Plasmid#232864PurposeExpresses human VPS13C^Halo in mammalian cellsDepositorAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-N-3HA-SREBP1-C-Flag
Plasmid#134286PurposeLentivector encoding 3XHA (N-term) and Flag (C-term)-tagged SREBP1DepositorInsertSREBP1 (Srebf1 Mouse)
UseLentiviralTags3x HA and FlagExpressionMammalianMutationmouse SREBP1 isoform a precursorPromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
JWW-1 human chimeric antibody
Plasmid#66748PurposeExpresses a rat/human chimeric IgG1 HPV16 L2-specific neutralizing antibody that recognizes HPV16 L2 amino acid region 17-36. JWW-1 works in ELISA/WB/HPV Neutralization assay.DepositorInsertsJWW-1 Heavy Chain Gamma
JWW-1 Light Chain Kappa
ExpressionMammalianMutationFirst 3 amino acids of rat light chain constant r…PromotermEF1 and rEF1Available SinceJuly 24, 2015AvailabilityAcademic Institutions and Nonprofits only