We narrowed to 7,298 results for: CAD;
-
Plasmid#31850DepositorInsertLuciferase RNAi
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for shRNA; Ef1alpha for mCherry-puromycinAvailable SinceJan. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRvCAHS1-mEGFP-NLS
Plasmid#205013PurposeThe vector contains 1kbp of the upstream and downstream regions of the cahs1 gene from Ramazzottius varieornatus, with the mEGFP gene with NLS sequence positioned in between.DepositorInsertmEGFP-NLS flanked by 1kbp upstream and downstream of the cahs1 gene from Ramazzottius varieornatus
UseTardigrade expressionAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRvSAHS1-mCherry-NLS
Plasmid#205009PurposeThe vector contains 1kbp of the upstream and downstream regions of the sahs1 gene from Ramazzottius varieornatus, with the mCherry gene with NLS sequence positioned in between.DepositorInsertmCherry-NLS flanked by 1kbp upstream and downstream of the sahs1 gene from R. varieornatus
UseTardigrade expressionAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-CHD7 (1-1899)
Plasmid#170143PurposeExpresses residues 1-1899 of CHD7 in insect cellsDepositorInsertchromodomain helicase DNA binding protein 7 (CHD7 Human)
TagsFLAGExpressionInsectMutationC-terminal truncation of residues 1900-2997Available SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-CHD7 (1-1547)
Plasmid#170144PurposeExpresses residues 1-1547 of CHD7 in insect cellsDepositorInsertchromodomain helicase DNA binding protein 7 (CHD7 Human)
TagsFLAGExpressionInsectMutationC-terminal truncation of residues 1548-2997Available SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-CHD7 (K999R)
Plasmid#170142PurposeExpresses CHD7 (K999R) in insect cellsDepositorInsertchromodomain helicase DNA binding protein 7 (CHD7 Human)
Tags6xHis and FLAGExpressionInsectMutationK999RAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOPS0380
Plasmid#133230PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with constitutive promoter Rlv3841pnifH (pOGG082), mCherry (EC15071) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
p7612 MSCV-P C-FlagHA 16E7 E10K
Plasmid#163303PurposeExpresses HPV16 E7 E10KDepositorInsertHPV16 E7 E10K
UseRetroviralTagsFlagHAMutationE10KPromoterMSCV LTRAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSUPER.retro.puro-shMePCE_shLARP7
Plasmid#113538PurposeRetroviral vector designed to knock down MePCE and LARP7 simultaneously.DepositorInsertshMePCE and shLARP7 (MEPCE Human)
UseRetroviralAvailable SinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFB-Flag-MyoD
Plasmid#25994DepositorAvailable SinceAug. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGL3-24p3/LCN2-282kB mut-LUC
Plasmid#46867Purposemurine 24p3 minimal promoter with NF-kB mutation as a luciferase reporterDepositorInsert24p3/lipocalin 2 proximal promoter
UseLuciferaseMutationNF- kB site is mutated (see comments)Promoter24p3 promoter (inactive)Available SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1617 pAAV SYN1 Nuc-EYFP
Plasmid#135567PurposeAn AAV vector expressing a neuronally expressed nuclear EYFP reporterDepositorInsertsempty
Nuc-EYFP
UseAAVTags3xNLSExpressionMammalianPromoterhSYN1Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-24p3/LCN2-282C/EBP mut-LUC
Plasmid#46868Purposemurine 24p3 minimal promoter with C/EBP mutation k as a luciferase reporterDepositorInsert24p3/lipocalin 2 proximal promoter
UseLuciferaseMutationCEBP site is mutated (see comments)Promoter24p3 promoter (inactive)Available SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
HOXB7 (human) HIS-tag pET
Plasmid#8538DepositorAvailable SinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-LplA(AAG)
Plasmid#61820PurposeContains GFP tag for direct live-cell fluorescence imaging of the resofurin ligaseDepositorInsertE. coli lipoic acid ligase
TagsGFPExpressionMammalianMutationE20A, F147A, H149GPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTYB3-human PUM1-HD MUT3-2 (C935S-Q939E)-intein-CBD
Plasmid#73302PurposeExpresses mutant human PUM1-HDDepositorInserthuman PUM1 Pumilio homology domain (PUM1 Human)
TagsinteinExpressionBacterialMutationC935S-Q939EAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 PARL-FLAG-CT S65A+T69A+S70A
Plasmid#13616DepositorTagsFLAGExpressionMammalianMutationchanged Ser 65, Thr 69 and Ser 70 to AlanineAvailable SinceJan. 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pRShygro shID3#1
Plasmid#19164DepositorInsertsmall hairpin RNA against inhibitor of DNA binding 3 (ID3 Human)
UseRNAi and RetroviralExpressionMammalianAvailable SinceSept. 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
pBV-Luc/Del-7
Plasmid#14968DepositorInsertc-myc promoter (-26/+334) (MYC Human)
UseLuciferaseExpressionMammalianMutation-26/+334 (relative to the P2 transcription initia…Available SinceMay 17, 2007AvailabilityAcademic Institutions and Nonprofits only