We narrowed to 31,326 results for: STI
-
Plasmid#162672PurposepET-21b(+) based plasmid for expression of the putative MHET hydrolase from Comamonas thiooxydans (Genbank WP_080747404.1) with C-terminal His tag, codon optimized for expression in E. coli K12.DepositorInsertPutative MHET hydrolase from Comamonas thiooxydans (Genbank WP_080747404.1) with signal peptide
TagsHisExpressionBacterialMutationcodon optimized for expression in E. coli K12PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-20a-3p
Plasmid#103341PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-20a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-20a-3p target (MIR20A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCJ197
Plasmid#162670PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating S131G mutation.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1
TagsHisExpressionBacterialMutationS131G; codon optimized for expression in E. coli …PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
NET23 pEGFP-N2 (1174)
Plasmid#62037Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCJ203
Plasmid#162678PurposepET-21b(+) based plasmid for expression of the putative MHET hydrolase from Comomonas thiooxydans (Genbank WP_080747404.1) with deletion of the predicted signal peptide (Phe2:Ala75)DepositorInsertPutative MHETase from Comomonas thiooxydans (Genbank WP_080747404.1) without 75 residue signal peptide
TagsHisExpressionBacterialMutationdeltaF2-A75; codon optimized for expression in E.…PromoterT7/lacAvailable SinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCJ205
Plasmid#162676PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating C224A anDepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1)
TagsHisExpressionBacterialMutationC224A, C529A; codon optimized for expression in E…PromoterT7/lacAvailable SinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ198
Plasmid#162671PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating F495I mutation.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1)
TagsHisExpressionBacterialMutationF495I; codon optimized for expression in E. coli …PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ196
Plasmid#162669PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating catalytic mutation, S225ADepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1)
TagsHisExpressionBacterialMutationS225A; codon optimized for expression in E. coli …PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ204
Plasmid#162677PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating C224H and C529F mutations.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1)
TagsHisExpressionBacterialMutationC224H, C529F; codon optimized for expression in E…PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ201
Plasmid#162674PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating C224W and C529SS mutations.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1)
TagsHisExpressionBacterialMutationC224W, C529SS; codon optimized for expression in …PromoterT7/lacAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-20a-5p
Plasmid#103342PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-20a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-20a-5p target (MIR20A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-18a-3p
Plasmid#103292PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-18a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-18a-3p target (MIR18A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-18a-5p
Plasmid#103293PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-18a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-18a-5p target (MIR18A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBAD-bARGSer-AxeTxe
Plasmid#192473PurposeSecond-generation bacterial acoustic reporter gene derived from SerratiaDepositorInsertsbARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterNative promoter from Enterococcus faecium and pBADAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCJ189
Plasmid#162666PurposepET-21b(+) based plasmid for expresion of MHETase (Genbank GAP38911.1) linked to PETase (Genbank GAP38373.1) from Ideonella sakaiensis by an 8 residue Gly/Ser linker; codon optimized for expression in E. coli K12, with C-terminal His tag.DepositorInsertMHETase (Genbank GAP38911.1) linked to PETase (Genbank GAP38373.1) from Ideonella sakaiensis by an 8 residue Gly/Ser linker
TagsHisExpressionBacterialMutationcodon optimized for expression in E. coli K12PromoterT7/lacAvailable SinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ190
Plasmid#162667PurposepET-21b(+) based plasmid for expresion of MHETase (Genbank GAP38911.1) linked to PETase (Genbank GAP38373.1) from Ideonella sakaiensis by a 12 residue Gly/Ser linker; codon optimized for expression in E. coli K12, with C-terminal His tag.DepositorInsertMHETase (Genbank GAP38911.1) linked to PETase (Genbank GAP38373.1) from Ideonella sakaiensis by a 12 residue Gly/Ser linker
TagsHisExpressionBacterialMutationcodon optimized for expression in E. coli K12PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-bLbCas12a-NLS(nucleoplasmin)-6xHis (RTW645)
Plasmid#114070PurposeT7 promoter bacterial expression plasmid for bacterial codon optimized LbCas12a with C-terminal NLS and His-tagDepositorInsertbacteria codon optimized LbCas12a with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
DBDmut-CA-RIT-NFAT1
Plasmid#63669PurposeConstitutively active NFAT1 and also unable to interact with AP-1 with four point mutations in the DNA binding loop that abolish DNA bindingDepositorInsertNFAT1 (Nfatc2 Mouse)
UseRetroviralTags3x HAExpressionMammalianMutationCA: PASSGSSASF mutated to PAAAGAAAAF, SPRTSPIMSP…Available SinceJuly 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG-2dV-Camui (T305D/T306D)
Plasmid#220368PurposeT305D/T306D phosphomimetic mutant of pCAG-2dV-CamuiDepositorInsertmVenus(Y145W)-mVenus(Y145W)-rat CaMK2 alpha(T305D/T306D)-mEGFP(A206K) (Camk2a Rat, Synthetic)
TagsmEGFP(A206K) and mVenus(Y145W)-mVenus(Y145W)ExpressionMammalianMutationchanged both Threonine 305 and 306 to aspartic ac…PromoterCAGAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only