We narrowed to 1,449 results for: TOX
-
Plasmid#211580PurposeCMV driven PARP1-E988K -eGFP expressing construct with IRES-Neomycin selectionDepositorAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pICE-EGFP-FLAG-PLIN3
Plasmid#161918PurposeExpresses human PLIN3 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-PSMD2
Plasmid#161917PurposeExpresses human PSMD2 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorInsert26S proteasome non-ATPase regulatory subunit 2 (PSMD2 Human)
TagsGFP-FLAGExpressionMammalianPromoterCMVAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV uN2C GFP (Ctl)
Plasmid#224355PurposeExpress GFP tagged upsteram ORF of NOTCH2NLC with a control size (12x) of GGC repeatsDepositorInsertuN2C
UseAAVTagseGFPExpressionMammalianMutationCodon-optimized for expression in human, so no pu…PromoterCMV + chimeric intyron (CAG)Available SinceOct. 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-PARP1_D770A-mCherry
Plasmid#192260PurposeExpresses PARP1 D770A mutant in mammalian cells. Tagged with mCherry.DepositorAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PARP1_R878A-mCherry
Plasmid#192261PurposeExpresses PARP1 R878A mutant in mammalian cells. Tagged with mCherry.DepositorAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7NT*-Bri2 113-231 R221E
Plasmid#138134PurposeExpresseds human Bri2 BRICHOS R221E mutant in E. coliDepositorInserthuman Bri2 BRICHOS R221E (ITM2B Human)
TagsNT* tag derived from spider silk proteinsExpressionBacterialPromoterT7Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-PARP1-del.p119K120S–eGFP
Plasmid#211554PurposeA piggyBac vector containing CMV-PARP1-del.p119K120S-eGFP-IRES-Neo cassette.DepositorInsertPARP1 (PARP1 Human)
UsePiggybacTagseGFPExpressionMammalianMutationdeletion of amino acids 119K 120SPromoterCMVAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-PARP1-delM43;F44I
Plasmid#211579PurposeCMV driven PARP1-delM43;F44I -eGFP expressing construct with IRES-Neomycin selectionDepositorInsertPARP1 (PARP1 Human)
TagseGFPExpressionMammalianMutationContains deletion of M43 and F44IAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-PARP1–eGFP
Plasmid#211552PurposeA piggyBac vector containing CMV-PARP1-eGFP-IRES-Neo cassette.DepositorAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pE-N1-RDH11
Plasmid#161916PurposeExpresses untagged human RDH11. Confers G418 resistance.DepositorAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCVpuro-Mito-DsRed1
Plasmid#87379PurposeRetroviral transfection of cells to express DsRed1 (Ex555, Em585) localising to the mitochondrial matrix via the transit peptide from human TXN2 (Thioredoxin).DepositorInsertTXN2 mitochondrial transit peptide (TXN2 Human)
UseRetroviralTagsDsRed1ExpressionMammalianMutationFirst 60 aa onlyPromoterRetroviral 5' LTR promoterAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-BPTF-sh5
Plasmid#83045PurposeMMLV LTR plasmid pSIREN-RetroQ-BPTF-sh5DepositorAvailable SinceOct. 24, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV hSyn syph-GFP-myc-BoNT/B(1-146)-iLID
Plasmid#122981PurposeAAV plasmid with human synapsin promoter driving synaptophysin fused to GFP, iLID(V416I) and BoNT/B amino acids 1-146. Co-express with SSPB-BoNT(147-441, Y365A) for vPA-BoNTDepositorInsertSyph-GFP-myc-BoNT/B(1-146)-iLID (Syp Rat, Synthetic)
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsinAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVTHM-Bptf-sh28
Plasmid#83278PurposeshRNA targeting BPTFDepositorAvailable SinceOct. 25, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLVTHM-Bptf-sh5
Plasmid#83277PurposeshRNA targeting BPTFDepositorAvailable SinceOct. 25, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSIREN-RetroQ-BPTF-sh3
Plasmid#73667PurposepSIREN-RetroQ vector containing shRNA sequence to BPTFDepositorAvailable SinceMarch 22, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pICE-EGFP-FLAG-TK1
Plasmid#161919PurposeExpresses human TK1 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11A
Plasmid#239212PurposeExpresses CDK11A in mammalian cell linesDepositorAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-RDH11
Plasmid#161924PurposeTo generate RDH11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against RDH11 exon 2.DepositorInsertsgRNA targeting RDH11 exon 2
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-HPGD-FLAGC
Plasmid#161915PurposeExpresses human HPGD with a C-terminal FLAG-GFP tag. Confers G418 resistance.DepositorAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-FLAG-BRAT1
Plasmid#161920PurposeExpresses human BRAT1 with a N-terminal GFP-FLAG tag. Confers G418 resistance.DepositorInsertBRCA1-associated ATM activator 1 (BRAT1 Human)
TagsGFP-FLAGExpressionMammalianPromoterCMVAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV uN2CpolyGly op GFP (NIID)
Plasmid#224356PurposeExpress GFP tagged upsteram ORF of NOTCH2NLC with an expansion (100x) of GGC repeats with codon optimization (NOT pure GGC repeats)DepositorInsertuN2C with a GGC repeat expansion (100x)
UseAAVTagseGFPExpressionMammalianMutationCodon-optimized for expression in human, so no pu…PromoterCMV + chimeric intron (CAG)Available SinceFeb. 5, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-N1-HSD17B11-WT-FLAGC
Plasmid#161903PurposeExpresses human HSD17B11 with a C-terminal FLAG-GFP tag. Confers G418 resistance.DepositorInserthydroxysteroid 17-beta dehydrogenase 11 (HSD17B11 Human)
TagsFLAG-GFPExpressionMammalianPromoterCMVAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-HSD17B13-WT-FLAGC
Plasmid#184501PurposeExpresses human HSD17B13 with a C-terminal FLAG-GFP tag. Confers G418 resistance.DepositorInsert17-beta-hydroxysteroid dehydrogenase 13 (HSD17B13 Human)
TagsFLAGC-GFPExpressionMammalianPromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Neo-CMV>hCCNL2
Plasmid#239219PurposeExpresses CCNL2 in mammalian cell linesDepositorAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11B
Plasmid#239211PurposeExpresses CDK11B in mammalian cell linesDepositorAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11A G567S
Plasmid#239214PurposeExpresses CDK11A with G567S resistance mutation in mammalian cell linesDepositorInsertcyclin dependent kinase 11A with G567S resistance mutation (CDK11A Human)
UseLentiviralExpressionMammalianMutationchanged Glycine 567 to SerineAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-HDRT-CD3z-truncCARgsg(anti-CD19)
Plasmid#215759PurposeHDR template to insert a truncated CD3-zeta-deficient CD19-CAR into CD247 exon 2 (enhanced expression by GSG-2A linker)DepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-HSD17B11-V16D-FLAGC
Plasmid#184500PurposeExpresses the V16D mutant of human HSD17B11 with a C-terminal FLAG-GFP tag. Confers G418 resistance.DepositorInsert17-beta-hydroxysteroid dehydrogenase 11 (HSD17B11 Human)
TagsFLAGC-GFPExpressionMammalianMutationV16DPromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-HSD17B11-L14P-FLAGC
Plasmid#184499PurposeExpresses the L14P mutant of human HSD17B11 with a C-terminal FLAG-GFP tag. Confers G418 resistance.DepositorInsert17-beta-hydroxysteroid dehydrogenase 11 (HSD17B11 Human)
TagsFLAGC-GFPExpressionMammalianMutationL14PPromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-HSD17B11-S172L-FLAGC
Plasmid#161904PurposeExpresses the catalytically inactive S172L mutant of human HSD17B11 with a C-terminal FLAG-GFP tag. Confers G418 resistance.DepositorInserthydroxysteroid 17-beta dehydrogenase 11 (HSD17B11 Human)
TagsFLAG-GFPExpressionMammalianMutationS172L; catalytically dead mutantPromoterCMVAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11B G579S
Plasmid#239213PurposeExpresses CDK11B with G579S resistance mutation in mammalian cell linesDepositorInsertcyclin dependent kinase 11B with G579S resistance mutation (CDK11B Human)
UseLentiviralExpressionMammalianMutationchanged Glycine 579 to SerineAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11B-p58
Plasmid#239215PurposeExpresses CDK11B p58 isoform in mammalian cell linesDepositorAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11B D562A
Plasmid#239217PurposeExpresses CDK11B with D562A kinase inactivating mutation in mammalian cell linesDepositorInsertcyclin dependent kinase 11B with D562A kinase inactivating mutation (CDK11B Human)
UseLentiviralExpressionMammalianMutationchanged Aspartic acid 562 to AlanineAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19-HDRT-CD3z-truncCAR(anti-CD19)
Plasmid#215758PurposeHDR template to insert a truncated CD3-zeta-deficient CD19-CAR into CD247 exon 2DepositorAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11B-p58 G579S
Plasmid#239216PurposeExpresses CDK11B p58 isoform with G579S resistance mutation in mammalian cell linesDepositorInsertcyclin dependent kinase 11B p58 isoform with G579S resistance mutation (CDK11B Human)
UseLentiviralExpressionMammalianMutationchanged Glycine 579 to SerineAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11B D562A, G579S
Plasmid#239218PurposeExpresses CDK11B with D562A kinase inactivating mutation and G579S resistance mutation in mammalian cell linesDepositorInsertcyclin dependent kinase 11B with D562A kinase inactivating mutation and G579S resistance mutation (CDK11B Human)
UseLentiviralExpressionMammalianMutationchanged Aspartic acid 562 to Alanine and changed …Available SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-hUV6-sgRNA-dCas9-KRAB-TagBFP2 (identifier AAAA-0244)
Plasmid#202553PurposeNontargeting control vector with TagBFP2DepositorInsertHumanized dCas9-KRAB-TagBFP2 (tag blue fluorescent protein 2) (TRIM28 S. Pyogenes (dCas9), H. sapiens (KRAB), Entacmaea quadricolor (TagBFP2))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2MutationPuromycin-resistance gene in the pLV hU6-sgRNA hU…Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPMS-2272
Plasmid#232292PurposeProtein ExpressionDepositorInsertAlpha bungarotoxin
ExpressionMammalianAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pET-22b DT 51E/148K
Plasmid#11081DepositorInsertDT
TagsHisExpressionBacterialMutation51E/148K, catalytically inactiveAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only