We narrowed to 5,009 results for: AAT
-
Plasmid#77481Purpose3rd generation lentiviral gRNA plasmid targeting human ERBB3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLXSN p200 CUX1
Plasmid#90470PurposeRetroviral vector expressing human p200 CUX1 with a Myc and HA tag at the N- and C-terminus, respectivelyDepositorInsertCUX1 (CUX1 Human)
UseRetroviralTagsHa and mycExpressionMammalianPromoterMoloney murine leukemia virus long terminal repeatAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
PRKDC gRNA (BRDN0001149021)
Plasmid#77864Purpose3rd generation lentiviral gRNA plasmid targeting human PRKDCDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT2-shP53
Plasmid#124261PurposeExpresses shRNA targeting P53. Construct has inverted repeats to be used in Sleeping beauty system.DepositorInsertshP53
ExpressionMammalianAvailable SinceApril 8, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pORANGE Dlg4-GFP KI
Plasmid#131477PurposeEndogenous tagging of PSD95: C-terminal (amino acid position: R721)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
VGAT scFv [L118/14]
Plasmid#206754PurposeMammalian Expression of VGAT scFV. Derived from hybridoma L118/14 scFv.DepositorAvailable SinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPten#1/Cre
Plasmid#173645PurposeExpresses a Pten-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pten (Pten Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 mTagBFP2 rat PGK1 shRNA
Plasmid#222869PurposeExpresses mTagBFP2 along with an shRNA against rat PGK1DepositorAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Gria2-GFP KI
Plasmid#131490PurposeEndogenous tagging of GluA2: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_CBFB_MYH11
Plasmid#205787PurposeExpress mEGFP-tagged fusion protein, CBFB_MYH11 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pDEST 3x Flag-pcDNA5-FRT/T0-BRCA1
Plasmid#52504Purposemammalian expression vector of BRCA1 wildtype siRNA resistantDepositorInsertBRCA1 (BRCA1 Human)
TagsFlagExpressionMammalianMutationsiRNA resistant sequence: AGTATAATCPromoterCMVAvailable SinceFeb. 4, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLentiCRISPRv1-sgPHGDH-G5
Plasmid#83913Purposestable knockoutDepositorInsertPhosphoglycerate dehydrogenase (PHGDH Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceOct. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATM gRNA (BRDN0001149033)
Plasmid#77531Purpose3rd generation lentiviral gRNA plasmid targeting human ATMDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAGI1 gRNA (BRDN0001487062)
Plasmid#78068Purpose3rd generation lentiviral gRNA plasmid targeting human MAGI1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-4
Plasmid#223225Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pRSITEP-puro-shWRN1
Plasmid#125783PurposeDOX-inducible expression of a short-hairpin RNA targeting human WRNDepositorInsertshWRN1 (WRN Human)
UseRNAiAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only