We narrowed to 17,253 results for: REV

#35926

Marian Waterman

Najdi et al Differentiation. 2012 Sep;84(2):203-13.

May 7, 2013

Academic Institutions and Nonprofits only

#35935

Marian Waterman

Najdi et al Differentiation. 2012 Sep;84(2):203-13.

May 7, 2013

Academic Institutions and Nonprofits only

#133662

Integration of MNN9-mTagBFP2 as an additional copy in genome, use auxotrophic marker TRP1(Kluyveromyces lactis). Marker for yeast early golgi.

Zhiping Xie

Zhu et al MBio. 2019 Sep 3;10(5). pii: mBio.01691-

Feb. 12, 2020

Academic Institutions and Nonprofits only

#126915

Plasmid containing integration cassette at XI-3 integration site in Saccharomyces cerevisiae for overexpression of XdCrtI and tHMG1

Irina Borodina

Milne et al FEMS Yeast Res. 2019 Sep 26. pii: foz062

Dec. 17, 2019

Academic Institutions and Nonprofits only

#139493

Insertion of the pSTL1 promoter and 24 MS2 stem loops in the GLT1 locus using HIS marker in S. cerevisiae

Serge Pelet

Wosika et al Nat Commun. 2020 Jun 23;11(1):3171. doi:

June 12, 2020

Academic Institutions and Nonprofits only

#69854

N-terminal tagging with mCitrine using URA3 as a selection marker in S. cerevisiae.

Liza Pon

Higuchi-Sanabria et al PLoS One. 2016 Jan 4;11(1):e0146120. doi

April 16, 2018

Academic Institutions and Nonprofits only

#163585

express N-terminal GFP tagged Dcp2 FL at endogenous level in S.cerevisiae

Michael Rosen

Xing et al Elife. 2020 Jun 19;9. pii: 56525. doi: 1

April 16, 2021

Academic Institutions and Nonprofits only

#87407

p425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#64538

Inducible MET15 gene

Joerg Stelling

Gnugge et al Yeast. 2015 Dec 9. doi: 10.1002/yea.3144

Aug. 28, 2015

Academic Institutions and Nonprofits only

#60334

Contains a promoter of two gal binding sites coupled wiht a core promoter derived from native Leucine promoter.

Hal Alper

Blazeck et al Biotechnol Bioeng. 2012 Nov;109(11):2884

Feb. 11, 2015

Industry, Academic Institutions, and Nonprofits

#189941

Single-integration vector for inserting PCP-NLS-GFPEnvy at the URA3 locus in Saccharomyces cerevisiae

Tineke Lenstra

Brouwer et al Nat Struct Mol Biol. 2023 May;30(5):692-

Feb. 14, 2023

Academic Institutions and Nonprofits only

#133673

Integration of ERG6-GFP as an additional copy in genome, use auxotrophic marker URA3(Candida albicans). Present on ER and lipid droplets.

Zhiping Xie

Zhu et al MBio. 2019 Sep 3;10(5). pii: mBio.01691-

April 23, 2020

Academic Institutions and Nonprofits only

#133633

Integration of VRG4-GFP as an additional copy in genome, use auxotrophic marker URA3(Candida albicans). Marker for yeast early golgi.

Zhiping Xie

Zhu et al MBio. 2019 Sep 3;10(5). pii: mBio.01691-

Jan. 2, 2020

Academic Institutions and Nonprofits only

#205163

express tdMCP-msfGFP(V206K)-GBI

Weirui Ma

Hu et al Elife. 2023 Mar 3;12:e82178. doi: 10.755

Oct. 18, 2023

Academic Institutions and Nonprofits only

#179887

Expresses TetOn3G transcription factor selectable by hygromycin resistance (Lentiviral vector)

Patrick Caswell

Gemperle et al Elife. 2022 Jun 16;11. pii: 76651. doi:

May 31, 2022

Academic Institutions and Nonprofits only

#174199

Lentiviral expression vector coding for Blasticidin, iRFP and 24X PP7 hairpins. All inserts are cloned in on the -strand to allow for splicing in when targeted into an intron of transcribed genes.

Daniel Larson

Wan et al Cell. 2021 May 27;184(11):2878-2895.e20.

Sept. 28, 2021

Academic Institutions and Nonprofits only