We narrowed to 27,513 results for: cas9
-
Plasmid#89633PurposeTargeted CpG methylationDepositorInsertsite-specific DNA-methyltransferase SssI
UseCRISPRTags3*FLAG and 6*HisExpressionMammalianPromoterCMVAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G3
Plasmid#86611PurposeExpresses the ATP1A1 G3 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 4. Px330-like plasmidDepositorInsertATP1A1 G3 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJCHph
Plasmid#185863PurposeThe CRISPR/Cas9-and-gRNA-expressing plasmid with a hygromycin B-resistent selectable markerDepositorInsertPTDH3-Cas9(N); PSNR52-srRNA-TSUP4; HphMX6
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYN2_1
Plasmid#184757PurposePlasmid for genome editing by CRISPR/Cas9DepositorInsertsCas9
sgRNA scaffold where sfGFP is replaced with gRNA protospacer of interest, which will be proceeded by the HDV Ribozyme
UseSynthetic BiologyTags2xNLSExpressionBacterial and YeastPromoterPGK1 and tRNA-Phe-HDV RibozymeAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-dCas9-MQ1(WT)-EGFP
Plasmid#89633PurposeTargeted CpG methylationDepositorInsertsite-specific DNA-methyltransferase SssI
UseCRISPRTags3*FLAG and 6*HisExpressionMammalianPromoterCMVAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187951PurposeFKBP12 (F36V mutant) degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
iPEmax-WT
Plasmid#239385PurposeFor inverse prime editor using Cas9-R221K-N394K in HEK294T cellsDepositorInsertCas9-R221K-N393K, M-MLV-RT
UseCRISPRTagsBPNLS and SV40 NLS, c-myc NLSExpressionMammalianMutationR221K, N394K in Cas9PromoterCMVAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-EN1082_Rad21_STOP
Plasmid#156450PurposeFor transient expression of Cas9 and sgRNA targeting mouse RAD21 stop codonDepositorAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE2-SpRY
Plasmid#159979PurposePrime editing in mammalian cellsDepositorInsertPE2-SpRY
TagsBpSV40 NLSExpressionMammalianPromoterCMVAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE2-SpRY
Plasmid#159979PurposePrime editing in mammalian cellsDepositorInsertPE2-SpRY
TagsBpSV40 NLSExpressionMammalianPromoterCMVAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR-TRE3G-dCas9-HaloTag
Plasmid#169448Purposeexpression of dCas9-HaloTagDepositorInsertdCas9-HaloTag
UseLentiviralExpressionMammalianAvailable SinceJune 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
LLP185 pLVP-dCas9-DNMT3a V2
Plasmid#100936PurposedCas9 and DNMT WT on C terminus, 4 NLS, driven by pGK promoter, with P2A site and PURO gene, within a lentiviral transfer backboneDepositorInsertdCas9, DNMT3a catalytic domain (DNMT3A Human, S.pyogenes)
UseCRISPR and LentiviralTags3xHA and 3xTy1ExpressionMammalianMutationD10A, H840A for dCas9Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-TRE3G-dCas9-HaloTag
Plasmid#169448Purposeexpression of dCas9-HaloTagDepositorInsertdCas9-HaloTag
UseLentiviralExpressionMammalianAvailable SinceJune 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
LLP185 pLVP-dCas9-DNMT3a V2
Plasmid#100936PurposedCas9 and DNMT WT on C terminus, 4 NLS, driven by pGK promoter, with P2A site and PURO gene, within a lentiviral transfer backboneDepositorInsertdCas9, DNMT3a catalytic domain (DNMT3A S.pyogenes, Human)
UseCRISPR and LentiviralTags3xHA and 3xTy1ExpressionMammalianMutationD10A, H840A for dCas9Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only