We narrowed to 19,677 results for: cat
-
Plasmid#113681PurposeA EFS driven de-catalyzed SaCas9 fused to KRAB domain for inhibition of transcription in targeted region.DepositorInsertde-catalyzed SaCas9
UseAAV and CRISPRTagsKRAB and NLSAvailable sinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST- IP2.0(codon for C.elegans)
Plasmid#109216PurposeIP2.0 for C. elegans (Codon optimization and introns).DepositorInsertIP2.0 (Inverse Pericam 2.0)
TagsHis-tagExpressionWormAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL10
Plasmid#107916PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
px458_2A_GFP_sgRNA_ELAVL1
Plasmid#106106PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting ELAVL1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA targeting ELAVL1 (ELAVL1 Human)
UseCRISPRAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS423-CUP1-His-Ubi
Plasmid#99541PurposeYeast episomal vector for expression of His-tagged ubiquitin; HIS3 markerDepositorAvailable sinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
PPP6C_pLX307
Plasmid#98360PurposeLentiviral expression of PPP6CDepositorAvailable sinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-UGCG-KO
Plasmid#80010PurposegRNA to knock out expression of UGCG gene. The product of this gene catalyzes the first step in synthesis of glycosphingolipids.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertUGCG (UGCG Human)
UseCRISPRAvailable sinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFRT/FLAG/HA MOV10 D645N
Plasmid#51717Purposeplasmid expresses FLAG/HA-tagged MOV10 D645NDepositorAvailable sinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pCDF1-p18INK4c
Plasmid#25650DepositorAvailable sinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pTYF-1xGfaABC1D-tTA
Plasmid#19977DepositorPublicationInsertGfaABC1D-tTA (GFAP Human, E.coli)
ExpressionMammalianAvailable sinceAug. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCHC005 (∆RE)
Plasmid#226199PurposeConjugation knockout plasmid (pK18mobsacB) to delete H16_0006 (Type I restriction endonuclease subunit).DepositorInsertHomology arms for type I restriction-modification system restriction subunit H16_A0006
UseSynthetic BiologyAvailable sinceNov. 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCRRNA-G0-R0
Plasmid#101803PurposeRepress mCherry and GFP independently, with different strengthsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available sinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available sinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMALcPP-MS2cp
Plasmid#203351PurposeExpresses His/MBP-tagged MS2-CP V75E/A81G variant in bacteriaDepositorInsertMS2 coat protein
TagsHx6-MBPExpressionBacterialMutationV75E and A81G, to prevent capsid assemblyAvailable sinceJuly 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_KRAB-MeCP2_KanR neo
Plasmid#167901PurposePiggyBac compatible plasmid expressing dCas9-KRAB-MeCP2 expression plasmidDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCas9-KRAB-MeCP2
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_class_I_2
Plasmid#164987PurposeExpression of gRNA targeting multiple HLA-A, HLA-B, and HLA-C genesDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against HLA class I
UseCRISPRExpressionMammalianAvailable sinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJEP309-pAAV-EFS-dSaCas9-KRAB-Dio-pA
Plasmid#113686PurposeAn EFS driven inverted de-catalyzed SaCas9 fused to the transcription repressor KRAB. dSaCas9-KRAB is floxed to render the system cre-dependent.DepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Cre/LoxTagsKRABAvailable sinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYES260-sc.eEF2
Plasmid#85119Purposeyeast expression of EEF2DepositorAvailable sinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCCL-PGK-SPdCas9-BFP-DNMT3A
Plasmid#66819PurposedCas9 fused to BFP and the human DNMT3A catalytic domainDepositorInsertdSpCas9-BFP-DNMT3A, catalytic domain of DNMT3A
TagsdSpCas9-BFP-DNMT3AExpressionMammalianAvailable sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only