We narrowed to 1,102 results for: cas12a
-
Plasmid#244221PurposeMammalian expression of dHyperLbCas12a with Blasticidin resistance selectable markerDepositorInsertdHyperLbCas12a
UseCRISPR and LentiviralExpressionMammalianMutationdHyperLbCas12a: D156R, D235R, E292R, E350R, and D…Available sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Inzolia library in pRDA_052
Pooled library#209551PurposeThe human, genome-wide, CRISPR knockout enAsCas12a gRNA library targets single genes and paralog pairs, triples, and quads with arrays of 4 gRNAs.DepositorUseCRISPR and LentiviralAvailable sinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAR015 Lenti pEF-dEnAsCas12a-NLS-NFZ-3XHA-T2A-BSD
Plasmid#195544PurposedCas12a effector fusion for manipulating transcriptionDepositorInsertLenti pEF-dEnAsCas12a-NLS-NFZ-3XHA-T2A-BSD
UseCRISPR and LentiviralTags3XHAExpressionMammalianPromoterpEF1aAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPD687 A2UCOE-HBB_IVS2-EnAsCas12a-BFP
Plasmid#249160PurposeOverexpression of EnAsCas12a-BFP with HBB IVS2 intron in 5' UTR with blasticidin resistance gene. Contains minimal A2UCOE and Cp36 recombination site.DepositorInsertA2UCOE-HBB_IVS2-EnAsCas12a-TagBFP (HBB Human, Synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSLQ11296: pHR-HSP-hyperdCas12a-miniVPR-EPS-puro
Plasmid#210604Purposeheat shock promoter - activated hyperdCas12a-based transcriptional activatorDepositorInserthyperdCas12a-miniVPR
UseCRISPR and LentiviralPromotertruncated hsp70Available sinceDec. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSL3287
Plasmid#139750PurposeBase Cas12a CRISPRi plasmidDepositorTypeEmpty backboneUseCRISPRExpressionBacterialAvailable sinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPD684 EnAsCas12a-BFP
Plasmid#249157PurposeOverexpression of EnAsCas12a-BFP with blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertEnAsCas12a-TagBFP
UseCRISPR; Cp36 donor dnaExpressionMammalianPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(B)
Plasmid#236041PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(A)
Plasmid#236039PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR2
Plasmid#176245PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR3
Plasmid#176246PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 3DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRI004-pYFAC-riboB-PgpdA-dLbCas12a-VPR-TtrpC
Plasmid#140197PurposeEpisomal expression of dLbCas12a-VPR. Filamentous fungi vector with AMA1 and riboB selection marker.DepositorInsertdLbCas12a-VPR
UseCRISPR and Synthetic Biology; Expression in asper…TagsVPR (VP64-p65-Rta), NLSMutationD832A DNase deactivatedPromoterPgpdAAvailable sinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTE4889
Plasmid#88905PurposeExpresses FnCpf1 crRNA and inactive/dead, humanized FnCpf1 nucleaseDepositorInsertsFn crRNA
hFnCpf1(D917A)
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMV and human U6Available sinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
EC67842
Plasmid#209516PurposeCloning in complete guide expression cassettes, with Cas12a (D156R)DepositorTypeEmpty backboneUseCRISPRAvailable sinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
SM283_EF1A-dEnAsCas12a-VPR-T2A-EGFP
Plasmid#244218PurposeMammalian expression of dEnAsCas12a-VPR with EGFP selectable markerDepositorInsertdEnAsCas12a-VPR
UseCRISPR and LentiviralExpressionMammalianMutationdEnAsCas12a: E174R, S542R, K548R, and D908AAvailable sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
SM272_EF1A-dHyperLbCas12a-VPR-T2A-EGFP
Plasmid#244210PurposeMammalian expression of dHyperLbCas12a-VPR with EGFP selectable markerDepositorInsertdHyperLbCas12a-VPR
UseCRISPR and LentiviralExpressionMammalianMutationdHyperLbCas12a: D156R, D235R, E292R, E350R, and D…Available sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
SM282_EF1A-dEnAsCas12a-P300-T2A-BlastR
Plasmid#244217PurposeMammalian expression of dEnAsCas12a-P300 with Blasticidin resistance selectable markerDepositorInsertdEnAsCas12a-P300
UseCRISPR and LentiviralExpressionMammalianMutationdEnAsCas12a: E174R, S542R, K548R, and D908AAvailable sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
SM284_EF1A-dEnAsCas12a-VPR-T2A-BlastR
Plasmid#244219PurposeMammalian expression of dEnAsCas12a-VPR with Blasticidin resistance selectable markerDepositorInsertdEnAsCas12a-VPR
UseCRISPR and LentiviralExpressionMammalianMutationdEnAsCas12a: E174R, S542R, K548R, and D908AAvailable sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
SM266_EF1A-dHyperLbCas12a-KRAB-T2A-BlastR
Plasmid#244205PurposeMammalian expression of dHyperLbCas12a-KRAB with Blasticidin resistance selectable markerDepositorInsertdHyperLbCas12a-KRAB
UseCRISPR and LentiviralExpressionMammalianMutationdHyperLbCas12a: D156R, D235R, E292R, E350R, and D…Available sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only