We narrowed to 5,505 results for: crispr cas9 grna plasmid
-
Plasmid#158151PurposeConstruction of inPTG-Cas9 plasmids expressing gRNA within an engineered intron for binary vector plant genome editing.DepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pFC334
Plasmid#87846PurposeAMA1 plasmid with Aspergillus optimized Cas9, argB selection marker and yA specific sgRNA expressed with ribozymesDepositorInsertsCas9
argB
yA specific sgRNA
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterA. nidulans gpdA promoter with Hammerhead ribozym…Available SinceMay 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_REC8_cterm
Plasmid#222522PurposeCas9/sgRNA plasmid for targeting REC8DepositorInsertCas9, REC8 sgRNA (REC8 Human, Synthetic)
UseCRISPRAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pELF2.1.0-gDNA
Plasmid#132454PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertELF2 (ELF2 Human)
UseCRISPRAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBRCA2.1.0-gDNA
Plasmid#132448PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertBRCA2 (BRCA2 Human)
UseCRISPRAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLF6.1.0-gDNA
Plasmid#132435PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertKLF6 (KLF6 Human)
UseCRISPRAvailable SinceDec. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
sg2
Plasmid#113967PurposeSingle short guide RNA targeting TACCACATTTGTAGAGGTTDepositorInsertsg2
ExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg3
Plasmid#113968PurposeSingle short guide RNA targeting CAATGTATCTTATCATGTCDepositorInsertsg3
ExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg2+sg3
Plasmid#113970PurposeDouble short guide RNA targeting TACCACATTTGTAGAGGTT & CAATGTATCTTATCATGTCDepositorInsertsg2+sg3
ExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBHM2679
Plasmid#241724PurposeConstruction of fused marker-sgRNA inserts for Cryptococcus neoformans genome editing, contains BSD marker for selection on blasticidin SDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBHM2678
Plasmid#241723PurposeConstruction of fused marker-sgRNA inserts for Cryptococcus neoformans genome editing, contains BLE marker for selection on phleomycinDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBHM2680
Plasmid#241725PurposeConstruction of fused marker-sgRNA inserts for Cryptococcus neoformans genome editing, contains BSR marker for selection on blasticidin SDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA_835
Plasmid#245327PurposeCas9 CRISPRko positive control guide; targets CD59DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
KO plasmid
Plasmid#135970PurposeExpresses SpCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneExpressionMammalianAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSGAb-km
Plasmid#121999PurposeA sgRNA expression plasmid for genome editing in Acinetobacter baumanniiDepositorInsertnone
UseCRISPRAvailable SinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSGAb-spe
Plasmid#122000PurposeA sgRNA expression plasmid for genome editing in Acinetobacter baumanniiDepositorInsertnone
UseCRISPRAvailable SinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
Level 1 P4 TaU6 guide acceptor
Plasmid#165600PurposeGoldenGate (MoClo) Level 1 Position 4 TaU6 guide acceptor plasmidInsertTaU6 promoter::LacZ::sgRNA scaffold
UseCRISPR and Synthetic Biology; Sgrna acceptor with…Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only