We narrowed to 5,385 results for: crispr cas9 grna plasmid
-
Plasmid#83932PurposeLentiviral vector expressing an sgRNA targeting SLC35B2 NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgSLC35B2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgTPST2
Plasmid#83933PurposeLentiviral vector expressing an sgRNA targeting TPST2 NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgTPST2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgCTRL-2
Plasmid#83935PurposeLentiviral vector expressing a control sgRNA. NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgCTRL-2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgCTRL-3
Plasmid#83936PurposeLentiviral vector expressing a control sgRNA. NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgCTRL-3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJMR19-ADE2
Plasmid#254119PurposeCandidozyma auris optimized vector expressing Cas9 and ADE2 targeting guide cassetteDepositorInsertCandidozyma auris ADE2 target sequence
UseCRISPRExpressionYeastAvailable SinceApril 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA3-RPB1-N-term
Plasmid#195112PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 N-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against first exon of RPB1 (N-terminal)
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA1-RPB1-N-term
Plasmid#195110PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 N-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against first exon of RPB1 (N-terminal)
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA2-2-RPB1-C-term
Plasmid#195109PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 C-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against last exon of RPB1 (C-terminal)
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA4-CTCF-3p-UTR
Plasmid#195106PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA3-CTCF-3p-UTR
Plasmid#195105PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA2-CTCF-prom
Plasmid#195104PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting upstream of the human CTCF promoter. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF promoter
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-NQL007-NANOG-sgRNA
Plasmid#175555PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse NANOG locus.DepositorInsertspCas9-nuclease and sgRNA against mouse NANOG STOP Codon
UseMouse TargetingExpressionMammalianAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-NPM1-gRNA for U2OS
Plasmid#238250PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to NPM1 locusDepositorInsertNPM1
UseCRISPRAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
HCP8
Plasmid#166110PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets the C-terminus of Whi5DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP5
Plasmid#166107PurposeThis plasmid encodes a Cas9 protein as well as a sgRNAs that targets the C-terminus of Cyr1.DepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP942-pX330-Sncg
Plasmid#181774PurposeCRISPR/Cas9 guide vectorDepositorInsertSncg guide
UseCRISPRExpressionMammalianAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiP926-pX330-Batf3
Plasmid#181772PurposeCRISPR/Cas9 guide vectorDepositorInsertBatf3 guide
UseCRISPRExpressionMammalianAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTFAM.1.0-gDNA
Plasmid#132443PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertTFAM (TFAM Human)
UseCRISPRAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV-NLS-SaCas9-NLS-3xHA-bGHpA;U6-Cre-2
Plasmid#237891PurposeCre-KO AAV vector#2 containing SaCas9 and its sgRNA targeting CreDepositorInsertsgRNA-Cre
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only