We narrowed to 6,377 results for: cat.2
-
Plasmid#215395PurposeExpression of the ectodomain(1-797) of the short isoform of the Very Low-Density Lipoprotein Receptor (VLDLR, UniProtKB; P98155-2) fused to a C-tag (EPEA) in th C- terminal for purification.DepositorInsertVLDLR (VLDLR Human)
TagsC-tag (EPEA)ExpressionMammalianMutationp.Ala798_Ala873delPromotertetOAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mIDUA)
Plasmid#170123PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse IDUA mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Idua Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEEF1D-FLAG (pcDNA 3.1+) LG6-1
Plasmid#37365DepositorAvailable SinceJuly 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFLAG-EEF1D (pcDNA 3.1+) LG3-1
Plasmid#37364DepositorAvailable SinceJuly 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
FUW-TetON-Sox10
Plasmid#115242PurposeLentiviral plasmid for tet-inducible expression of Sox10 (generated from plasmid #20321)DepositorInsertSOX10 (SOX10 Human)
UseLentiviralAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTO_CHMP4B_LAP
Plasmid#101850PurposeTet-inducible expression of human CHMP4B with a C-terminal GFP and long linker (LAP tag), compatible with Flp-In recombination for stable integrationDepositorInsertCharged Multivesicular Body Protein 4B (CHMP4B Human)
UseGateway cloning, flp-frt recombination, tet-induc…TagsLocalization and Affinity Purification (LAP) tagExpressionBacterial and MammalianPromoterCMVAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-Mito-7
Plasmid#55500PurposeLocalization: Mitochondria, Excitation: 462, Emission: 492DepositorAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mPCSK9)
Plasmid#170122PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse PCSK9 mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Pcsk9 Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-Tet2 CD Mut
Plasmid#72220PurposeExpress flag-tagged mouse Tet2 catalytic domain - catalytic dead mutant.DepositorInsertTen-Eleven Translocation 2 (Tet2 Mouse)
TagsflagExpressionMammalianMutationThe plasmid expresses TET2 catalytic domain (cata…PromoterCMVAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
p11_AaC60αβ/C20
Plasmid#229506PurposeExpresses Anthoceros agrestis Chaperonin 60α, Chaperonin 60β, Chaperonin 20DepositorInsertsChaperonin 60α
Chaperonin 60β
Chaperonin 20
ExpressionBacterialMutationN terminus chloroplast transit peptide truncationPromoterT7Available SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-CUL2-pCMV7.1
Plasmid#155020PurposeN-terminal 3xFLAG-tagged CUL2 in a pCMV7.1 vectorDepositorAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE:hTRAAK(Q258K)
Plasmid#133077PurposeX. laevis expression vector. It will generate the human TRAAK channelDepositorInsertPotassium channel subfamily K member 2 (KCNK2, TREK-1), Q258K (Kcnk2 Mouse)
MutationQ258KPromoterT7Available SinceOct. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P-1 BICC FL
Plasmid#112998PurposeFor protein expression and purification of full-length Drosophila BicCDepositorInsertfull length BicC (BicC Fly)
ExpressionBacterialAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQTEV-PFDN2
Plasmid#31329DepositorAvailable SinceMarch 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pQTEV-TAGLN2
Plasmid#31569DepositorAvailable SinceMarch 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPAeBlueHPV16LR
Plasmid#185893Purpose2-micron plasmid of AeBlue + HPV16 L1 expression module at RPL25 locusDepositorInsertPALD6>AeBlue>TPGK1- PSe.GAL2> HPV16-L1_C-6*H > TRPL41B
ExpressionYeastMutationNoneAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
coreR2 (1-387)
Plasmid#115648Purposeexpression of truncated Rag2DepositorInsertRag2 core (1-387) (Rag2 Mouse)
Tags8XHis-MBP-PreScissionExpressionMammalianMutationtruncated Rag2 (aa 1-387)Available SinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits only