We narrowed to 6,267 results for: cat.2
-
Plasmid#125429PurposeCRISPR-mediated repression of CRY2. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR VPS13C-TSS-guide4
Plasmid#125415PurposeCRISPR-mediated repression of VPS13C. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR OPTN TSS-guide2
Plasmid#118182PurposeCRISPR-mediated repression of OPTN. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR-SUMO1
Plasmid#114388PurposepDONR vector with SUMO1 geneDepositorInsertSUMO1 (SUMO1 Human)
ExpressionMammalianMutationQ29H compared with NCBI reference NP_003343.1Available SinceAug. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
Guzit
Bacterial Strain#196902PurposeGuzit is a RNase HI(rnhA) His-tagged E. coli strain made for a cell-free expression system.DepositorBacterial ResistanceKanamycinAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNase III-His
Bacterial Strain#196903PurposeRNase III-His is an E. coli strain made for a cell-free expression system.DepositorBacterial ResistanceKanamycinAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZ M2rtTA_CAGG TetON-Sox10
Plasmid#115240PurposeRMCE donor vector for inducible expression of SOX10 constitutive expression of m2rtTA (generated from plasmid #112668)DepositorInsertSOX10 (SOX10 Human)
ExpressionMammalianAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
DVA_p15A_AF
Plasmid#217604PurposeDestination vector with ampicillin resistance and p15A origin of replication. Carries A-F CIDAR MoClo overhangs for level 0 or 2 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
DVA_p15A_AH
Plasmid#217602PurposeDestination vector with ampicillin resistance and p15A origin of replication. Carries A-H CIDAR MoClo overhangs for level 0 or 2 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
DVA_pBR322_AH
Plasmid#217606PurposeDestination vector with ampicillin resistance and pBR322 origin of replication. Carries A-H CIDAR MoClo overhangs for level 0 or 2 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
DVA_p15A_AG
Plasmid#217603PurposeDestination vector with ampicillin resistance and p15A origin of replication. Carries A-G CIDAR MoClo overhangs for level 0 or 2 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
DVA_p15A_EH
Plasmid#217605PurposeDestination vector with ampicillin resistance and p15A origin of replication. Carries E-H CIDAR MoClo overhangs for level 0 or 2 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
DVA_pBR322_AG
Plasmid#217607PurposeDestination vector with ampicillin resistance and pBR322 origin of replication. Carries A-G CIDAR MoClo overhangs for level 0 or 2 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
DVA_pBR322_AF
Plasmid#217608PurposeDestination vector with ampicillin resistance and pBR322 origin of replication. Carries A-F CIDAR MoClo overhangs for level 0 or 2 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
DVA_pBR322_EH
Plasmid#217609PurposeDestination vector with ampicillin resistance and pBR322 origin of replication. Carries E-H CIDAR MoClo overhangs for level 0 or 2 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSICO-CPSF6-358-eGFP
Plasmid#110693PurposeExpresses a truncated form of CPSF6 (CPSF6-358 originally described in Lee et al. Cell Host Microbe 2010) fused with eGFPDepositorInsertCPSF6-eGFP (CPSF6 )
UseLentiviralTagsEGFPMutationTruncation of CPSF6 isoform 2 at amino acid 358Available SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast SHMT2 CD
Plasmid#106302PurposeExpresses SHMT2 K280A catalytic site mutantDepositorInsertserine hydroxymethyltransferase 2 (SHMT2 Human)
UseRetroviralExpressionMammalianMutationK280A catalytic site mutation, Silent mutations d…Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 D122A pcDNA3
Plasmid#206068Purposeexpression of rabbit Cav2.2 calcium channel with a N-terminal GFP tag and a D122A mutation that disrupts the interaction with ?2?-1DepositorAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZ M2rtTA_CAGG TetON-Sox10 with GFP
Plasmid#115241PurposeRMCE donor vector for inducible expression of SOX10 and GFP and constitutive expression of m2rtTA (generated from plasmid #112668)DepositorAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only