We narrowed to 32,724 results for: eng
-
Plasmid#226270PurposePlasmid expressing the SEC22 allele from S288C, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-NCYC110
Plasmid#226279PurposePlasmid expressing the SSD1 allele from NCYC110, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDLterm
Plasmid#211903PurposeBase plasmid for dual-luciferase constructs to measure terminator strengthDepositorTypeEmpty backboneUseLuciferaseExpressionPlantPromoter35S enhancer + 35S minimal promoterAvailable SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Zhou-pLOV-GFP-Luc
Plasmid#161030PurposeLentiviral vector expressing GFP and luciferase for use as a reporter in pseudovirus production and infection.DepositorInsertGFP and luciferase
UseLentiviralAvailable SinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4506
Plasmid#200255PurposePnpr-4 TeTx mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of TeTx RFPDepositorInsertTeTx
TagsmCherryExpressionWormPromoterPnpr-4Available SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4693
Plasmid#200784PurposePtwk-40s EGFP unc-54 3' UTR C.elegans AVA and other neurons expression of EGFPDepositorInsertno
TagsGFPExpressionWormPromoterPtwk-40sAvailable SinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH2673
Plasmid#199691PurposePnmr-1 FLPe unc-54 3' UTR C.elegans AVA/E/D premotor IN and others expression of FLPeDepositorAvailable SinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
TtA_pET29b
Plasmid#215432PurposeExpression construct for TtA gene, codon optimized for expression in E. coliDepositorInsertTtA
ExpressionBacterialAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDonor_RB-TnV2_pJEx
Plasmid#213908PurposeBarcoded mariner transposon with crystal violet-inducible outward promoter - barcodes can be added via FseI-SbfI restriction sitesDepositorInsertmariner transposon with kan resistance and EilR/pJEx and FseI-SbfI sites for barcode insertion
ExpressionBacterialAvailable SinceFeb. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGAL1-VP1 (LEU2)
Plasmid#182480PurposeYeast integrative plasmid for expressing deltaVP1, an NLS deletion mutant of Murine polyomavirus VP1 (GAL1 promoter). Contains leucine auxotrophic marker (K. lactis LEU2).DepositorInsertdeltaVP1
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL1Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLS.544
Plasmid#184961PurposeTest effect of a1/a2 length on editing murF using retron recombineeringDepositorInsertEco1 RT and recombineering ncRNA, murF G1359A, a1/a2 length: 22
ExpressionBacterialMutationmurF donor G1359A, a1/a2 length extended to 22 bpPromoterT7/lacAvailable SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNCS-Clover4-LUMABS-HA
Plasmid#183486PurposeTo express the Clover4-LUMABS-HA sensor for Avian Influenza Virus antibody detection.DepositorInsertClover4-LUMABS-HA
ExpressionBacterialAvailable SinceAug. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-NF1-L1-dSpRY
Plasmid#177681PurposeGateway entry clone (attL1 & attR5) for dimeric FokI-dCas9-SpRY genome editingDepositorInsertFokI-dCas9-SpRY
UseCRISPR; Gateway compatible foki-dcas9-spry entry …TagsNLSExpressionPlantAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-NF1-L2-dSpRY
Plasmid#177682PurposeGateway entry clone (attL1 & attR5) for dimeric FokI-dCas9-SpRY genome editingDepositorInsertFokI-dCas9-SpRY
UseCRISPR; Gateway compatible foki-dcas9-spry entry …TagsNLSExpressionPlantAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-NF-L2-dMb2Cas12a
Plasmid#177684PurposeGateway entry clone (attL1 & attR5) for dimeric FokI-dMb2Cas12a genome editingDepositorInsertFokI-dMb2Cas12a
UseCRISPR; Gateway compatible foki-dmb2cas12a entry …TagsNLSExpressionPlantAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
Pb mD3S4-dN
Plasmid#180252PurposeP. berghei D3 (502-617) construct with N516T, S533N and N539Q mutations to abolish N-glycosylation was used for crystallization.DepositorInsertD3 of P. berghei HAP2 with N-glycosylation sites mutated
Tags6HisExpressionMammalianMutationN516T, S533N and N539QAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1-Rnt1-dsRBD(+6A)
Plasmid#171552PurposeEncoding part of the budding yeast Rnt1 protein from L366 to S453DepositorInsertRnt1 (RNT1 Budding Yeast)
ExpressionBacterialMutationa six-alanine insertion in the L1 regionAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1-Rnt1-dsRBD(+3A)
Plasmid#171551PurposeEncoding part of the budding yeast Rnt1 protein from L366 to S453DepositorInsertRnt1 (RNT1 Budding Yeast)
ExpressionBacterialMutationa three-alanine insertion in the L1 regionAvailable SinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1-Rnt1-dsRBD(+6)
Plasmid#171550PurposeEncoding part of the budding yeast Rnt1 protein from L366 to S453DepositorInsertRnt1 (RNT1 Budding Yeast)
ExpressionBacterialMutationa six amino acid_TRLTEG_insertion in the L1 regionAvailable SinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only