We narrowed to 1,731 results for: plasmids pcas
-
Plasmid#223323PurposeHuman codon optimized Cas9 expressing plasmid that carries the sgRNA T2 from Mali et al., 2013 (10.1126/science.1232033).DepositorInsertSpCas9 and sgRNA-T2 (cas9 )
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP (PX458)
Plasmid#48138PurposeCas9 from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorHas ServiceCloning Grade DNAInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-GFP (PX461)
Plasmid#48140PurposeCas9n (D10A nickase mutant) from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorInserthSpCas9n
UseCRISPRTags3XFLAG and GFPExpressionMammalianMutationCas9 D10A nickase mutantPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX330_SpCas9_USP7 Exon 3 gRNA
Plasmid#131257PurposepX330-U6-Chimeric_BB-Cbh-hSpCas9 vector expressing a guide RNA targeting exon 3 of USP7DepositorInserthumanised S. pyogenes Cas9 nuclease
ExpressionMammalianAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-Puro
Plasmid#117686PurposeThe plasmids pSpCas9 (BB)-2A-Puro (Addgene, #48139) and eSpCas9 (1.1) (Addgene, #71814) were combined to express both “enhanced specificity” Cas9 and puromycin resistance protein.DepositorInserteSpCas9(1.1)
UseCRISPRTagsPuroR (R166H)ExpressionMammalianMutationK848A, K1003A, R1060APromoterU6Available SinceFeb. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Myc-Oct3/4-IP
Plasmid#13460DepositorAvailable SinceJan. 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCAG-memRFP-3xPax7gRNA
Plasmid#224569PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and membrane RFP reporter.DepositorInsertmRFP1
UseCRISPRTagsMembrane localization signalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCASP-SptP120-TD-HilA
Plasmid#153330PurposeTriggers secretion of SptP120 fused to the HA4-7c12 Tandem Monobody from Salmonella upon induction with arabinoseDepositorInsertSptP120-HA4-7c12 Tandem Monobody
UseSalmonella expressionAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Kan
Plasmid#232096PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xPax7gRNA
Plasmid#224570PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCASP-SptP35-TD-HilA
Plasmid#153332PurposeTriggers expression of SptP35 fused to the HA4-7c12 Tandem Monobody from Salmonella upon induction with arabinoseDepositorInsertHA4-7c12 Tandem Monobody
UseSalmonella expressionAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCASP-SptP92-TD-HilA
Plasmid#153331PurposeTriggers secretion of SptP92 fused to the HA4-7c12 Tandem Monobody from Salmonella upon induction with arabinoseDepositorInsertSptP92-HA4-7c12 Tandem Monobody
UseSalmonella expressionAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hNme2Cas9-NLS(SV40)-3xFLAG (KAC582)
Plasmid#134331PurposeCAG promoter expression plasmid for human codon optimized Nme2Cas9 nuclease with C-terminal NLS (SV40) and 3x FLAG tagDepositorInserthuman codon optimized Nme2Cas9
TagsNLS(SV40)-3xFLAGExpressionMammalianPromoterCAGAvailable SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCARGO-RMCE-Xist
Plasmid#233268PurposeCARGO plasmid containing ~22kb dox-inducible Xist transgeneDepositorInsert22kb Xist gene, including introns
ExpressionMammalianAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-C9orf72
Plasmid#83439PurposeExpresses Cas9 and a gRNA targeting C9orf72DepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCaMKII-tTAc
Plasmid#172125PurposeExpression of InteinC-tTAC in CaMKII positive cellsDepositorInsertpCaMKII, tTAc
UseAAVPromoterCaMKIIAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only