We narrowed to 4,533 results for: Gaa
-
Plasmid#133611PurposeCD95-1-2xPP7, NLS-PCP-DNCR2-P2a-BFPDepositorInsertCD95-1-2xPP7, PCP-DNCR2, BFP
ExpressionMammalianAvailable SinceNov. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
FLAG-ADA add back mutant pCMV5
Plasmid#17554DepositorInsertFLAG-FoxO1-ADA
TagsFLAGExpressionMammalianMutationsiRNA-resistant Foxo1 by replacing 3 residues (un…Available SinceOct. 17, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A1T
Plasmid#62256Purposeexpression of A1T sgRNA from the arabinose-inducible promoterDepositorInsertA1T sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSR-puro-Sec6
Plasmid#31118DepositorAvailable SinceSept. 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
beta4-nAChR (DPM negative control)
Plasmid#86651Purposeexpression of control shRNADepositorInsertCHRNB4 (control)
UseRNAiExpressionMammalianPromoterH1Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G20-R0
Plasmid#101807PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A4NT
Plasmid#62261Purposeexpression of A4NT sgRNA from the arabinose-inducible promoterDepositorInsertA4NT sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A3NT
Plasmid#62259Purposeexpression of A3NT sgRNA from the arabinose-inducible promoterDepositorInsertA3NT sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSuper-TatSF1 GH
Plasmid#31120DepositorAvailable SinceJuly 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
CTp130-Reporter-NT
Plasmid#256440PurposeMammalian expression of a TSM with half of GFP-2A-BFP with non-targeting spacerDepositorInsertTrans-splicing module with half of GFP-2A-BFP with non-targeting spacer
ExpressionMammalianPromoterSFFVAvailable SinceMay 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hITGB1-gRNA2
Plasmid#249223PurposeITGB1 CRISPR KODepositorAvailable SinceFeb. 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
lenti-hygro-sgDDX6-1
Plasmid#240004PurposeExpresses human sgDDX6 in mammalian cellsDepositorInsertsgDDX6
UseLentiviralAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
U6-miR.FF4
Plasmid#235256PurposeNon-intronic (U6-driven) expression of miR-FF4 (FF4 hairpin)DepositorInsertFF4 hairpin
UseSynthetic BiologyExpressionMammalianPromoterU6Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp4
Plasmid#238037PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp2
Plasmid#238035PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp3
Plasmid#238036PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp6
Plasmid#238039PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp5
Plasmid#238038PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA_SRR134.3_miRFP670
Plasmid#163754PurposegRNA expression vector containing the miRFP670 fluorescent marker to target the region downstream of the SRR134 SOX2 enhancer in human cells.DepositorInsertgRNA_SRR134.3
UseCRISPRTagsmiRFP670ExpressionMammalianPromoterU6Available SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 1- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210737PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 1DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianPromoterH1 and eCMVAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 4- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210748PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 4DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 4
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 2- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210746PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 2DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 2
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1- sgCTG Bilbo -eCMV-CjSpD8A-3XFLAG-SV40 NLS-ITR2
Plasmid#210749PurposeCoding for CjSp D8A alongside Bilbo sgRNA targeting CAG repeatsDepositorInsertsCjSp D8A Cas9
Bilbo sgCAG
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationD8A, N-terminal Cj Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 2- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210738PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 2DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianPromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 4- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210740PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 4DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianPromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 1- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210745PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 1DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 1
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
tet pLKO.1-shNUP37 v2 puro
Plasmid#192344PurposeLentiviral expression vector for an inducible shNUP37 v2DepositorInsertshNUP37 v2 (NUP37 Human)
UseLentiviralAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX458-MAFB-sg
Plasmid#194720Purposepx458 with guide RNA that target hMAFBDepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgSNRPA guide 1
Plasmid#193598PurposeSNRPA knockoutDepositorInsertsgSNRPA guide 1 (SNRPA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only