We narrowed to 11,151 results for: AGA
-
Plasmid#155061PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Rorb sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239029PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ClipF-HA-2a-Hu VGAT sesRNA-2a-smV5-2a-tTA2-WPRE
Plasmid#239031PurposeExpression of ClipF, sesRNA in mammalian cells, with smV5 and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(NANOG_g2)-PGKpuroBFP-W
Plasmid#211975PurposeExpress gRNA against NANOG with puro and BFPDepositorInsertsgRNA targeting NANOG (NANOG Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
px458-CCND1
Plasmid#172630PurposeExpresses a gRNA against CCND1 and Cas9 from S. pyogenes with 2A-EGFPDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTT5-hSDC1-2
Plasmid#52378Purposeexpresses human Syndecan-1 GAGAL replaced with GADEV of SDC2 in HEK293-EBNA1 (293E) suspension culture.DepositorInsertSDC1 (SDC1 Human)
ExpressionMammalianMutationGAGAL of syndecan-1 replaced with of GADED of SDC…PromoterCMVAvailable SinceDec. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUDP123
Plasmid#107269PurposepUDP123 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes OpADE2 and OpNIAD and Spcas9D147Y P411T in O. parapolymorpha (HH-gRNAOpADE2-HDV-linker-HH-gRNAOpNIAD-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting OpADE2 and NIAD in O. parapolymorpha
ExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTT5-hSDC1-4
Plasmid#52375Purposeexpresses human Syndecan-1 GAGAL replaced with GDLDD of SDC4 in HEK293-EBNA1 (293E) suspension culture.DepositorInsertSDC1 (SDC1 Human)
ExpressionMammalianMutationGAGAL of syndecan-1 replaced with GDLDD of SDC4; …PromoterCMVAvailable SinceDec. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
px458-AMBRA1 (optimized for N-terminal knock-in)
Plasmid#172608PurposeExpresses a gRNA against AMBRA1 and Cas9 from S. pyogenes with 2A-EGFP. This gRNA is suitable for the N-terminal knock-in of AMBRA1.DepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLIK_hygro_3xflag_NRF2(RR)
Plasmid#136535PurposeLentiviral expression vector for an inducible 3xflag-tagged NRF2(a1584c_a1586t_a1589g)DepositorInsertNRF2(1584A>C,1586A>T,1589A>G) (NFE2L2 Human)
UseLentiviral; Destinatioin vector for gateway cloni…Tags3x FLAGExpressionMammalianMutationThis plasmid is developed by mutating 3 base pair…Available SinceJuly 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN_TTmiRC2_3xflag_NRF2(RR)
Plasmid#136522PurposeUsed as a donor vector containing N-term 3xFLAG to clone into pSLIKDepositorInsertNRF2(1584A>C,1586A>T,1589A>G) (NFE2L2 Human)
UseEntry vector for gateway cloningTags3x FLAGMutationThis plasmid is developed by mutating 3 base pair…Available SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG Barcode4
Plasmid#229065PurposeExpression mappingDepositorInsertCAG Barcode4
UseAAVAvailable SinceDec. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode19
Plasmid#226196PurposeExpression mappingDepositorInsertSyn Barcode19
UseAAVAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCoHygro L16_shRNA of spliced Copia
Plasmid#71389Purposeknock down expression of spliced Copia in Drosophila melanogasterDepositorInsertCopia
ExpressionInsectPromoterU6Available SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgSik1_2nd-hU6-sgSik3_1st
Plasmid#177218PurposeExpresses a Sik3-targeting and a non-targeting gRNAs and Cre-recombinaseDepositorInsertsgSik1_2nd/sgSik3_1st
UseLentiviralPromotermU6/hU6Available SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT2/shαSMA/GFP4_Seq2/clone1
Plasmid#201402PurposeKnockdown of alpha-SMA. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertalpha-SMA
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1B
Plasmid#185383PurposeFor mammalian expression of shRNA: GAGCAGAAGAGGATGAATTTA that targets human PPM1BDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-PHGDH-int1
Plasmid#188681Purposecontrol sgRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAIP4_4WDC
Plasmid#234153PurposeHeterologous protein expression of DELTA-actitoxin-Afr1a (DELTA-AITX-Afr1a) (Fragaceatoxin C) (fraC) in Escherichia coliDepositorInsert4WDC
Tags10x HisTag-Smt3ExpressionBacterialPromoterT7Available SinceMarch 6, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only