We narrowed to 16,945 results for: RAN-1
-
Plasmid#206185Purposein vitro transcription of RNA encoding human ACVR1 with mutations T189V, S192A, and R206HDepositorInsertactivin A receptor type 1 (ACVR1 Human)
UseIn vitro transcriptionTagsFLAG tagMutationT189V, S192A, R206HAvailable SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
ACVR1-VASS-R206H
Plasmid#206186Purposein vitro transcription of RNA encoding human ACVR1 with mutations T189V, S190A, and R206HDepositorInsertactivin A receptor type 1 (ACVR1 Human)
UseIn vitro transcriptionTagsFLAG tagMutationT189V, S190A, R206HAvailable SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2967
Plasmid#144443PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2826
Plasmid#143631PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2824
Plasmid#143630PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
DNMT2Δ191-237
Plasmid#198382PurposeBacterial expression plasmid for human DNMT2 deletion mutant; for binding assaysDepositorInsertDNMT2 (TRDMT1 Human)
TagsHis-tagExpressionBacterialMutationdeleted amino acids 191-237PromoterT7Available SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2827
Plasmid#143632PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pB80-KIF1A(1-365)-GCN4-GFP-SSPB(micro)
Plasmid#174632PurposeHighly processive KIF1A for optogenetic heterodimerization to iLID via SSPB(micro)DepositorInsertKIF1A(1-365)-GCN4-GFP-SSPB(micro) (Kif1a Synthetic, Mouse)
TagsGFP-SSPB(micro)ExpressionMammalianMutationmmKIF1A(aa1-365): Pro202Ala; EGFP: Met1Del; SSPB:…PromoterChicken beta-actinAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR/D-Topo CDS A. thaliana IMPORTIN ALPHA 2
Plasmid#175816PurposepENTR plasmid with CDS of Arabidopsis thaliana IMPORTIN ALPHA ISOFORM 2 (AT4G16143.1) without stop codon for C-terminal epitope tagsDepositorInsertIMPORTIN ALPHA ISOFORM 2 (IMPA-2 Mustard Weed)
UsePentr plasmid for gateway cloningTagsnoneMutationnatural polymorphism P65S, annotated in Genbank f…PromoternoneAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1972 - [1-2] ENTR - Flour - TagBFP2(NLS(2), no_atg, no_stop)
Plasmid#159844PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Flour - TagBFP2(NLS(2), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFd029.R2.RFP
Plasmid#137972PurposeExpresses Prochlorococcus marinus NATL1A Fd 1 fused to mRFPDepositorInsertProchlorococcus marinus NATL1A ferredoxin 1 fused to monomeric RFP
UseSynthetic BiologyAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFd030.R2.RFP
Plasmid#137973PurposeExpresses Prochlorococcus marinus NATL2A Fd 1 fused to mRFPDepositorInsertProchlorococcus marinus NATL2A ferredoxin 1 fused to monomeric RFP
UseSynthetic BiologyAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFd031.RFP
Plasmid#137974PurposeExpresses Prochlorococcus marinus MIT9211 Fd 1 fused to mRFPDepositorInsertProchlorococcus marinus MIT9211 ferredoxin 1 fused to monomeric RFP
UseSynthetic BiologyAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-shNts1
Plasmid#132713PurposeEncodes short hairpin RNA (shRNA) #1 that targets the the 3’-untranslated region of the rat Nts geneDepositorAvailable SinceOct. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -