We narrowed to 5,731 results for: mos
-
Plasmid#122014PurposeMammalian vector for parallel SLIC cloning containing the VEGF signal sequence for secretion, N-terminal His6-Smt3Star (SumoStar*) and different C-tag optionsDepositorTypeEmpty backboneTagsHis6-Smt3Star and Multi3: depending on the LP2 pr…ExpressionMammalianAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pSR35
Plasmid#69256Purposephsp16.41::CRE for integration on ttTi14024, Chr XDepositorInsertCre recombinase
UseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterhsp16.41Available SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBM23-pyrF-NT
Plasmid#174384PurposepBM23 contained pyrF and mini-CRISPR.DepositorInsertpyrF-NT
UseTemplate for cloning fragments for chromosomal in…ExpressionBacterialAvailable SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBM23-pyrF-CS
Plasmid#174396PurposepBM23 contained pyrF and mini-CRISPR.DepositorInsertpyrF-CS
UseTemplate for cloning fragments for chromosomal in…ExpressionBacterialAvailable SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-mTUT1
Plasmid#60038PurposeMammalian expression of FLAG-tagged mouse TUT1DepositorAvailable SinceNov. 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCfB6681
Plasmid#106157PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6637, integration into Yarrowia lipolytica chromosomal location IntE_3, USER site for cloning, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSR28
Plasmid#69253Purposephlh-8::CRE for integration on ttTi14024, Chr XDepositorInsertCre recombinase
UseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterhlh-8Available SinceOct. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-GFP (F64L, S65T, V163A)-kanMX6
Plasmid#53183Purposechromosomal tagging with stable GFPDepositorInsertkanMX6
UseYeast genomic targetingTagsGFP (F64L, S65T, V163A)Available SinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-C11orf83-V5
Plasmid#65843PurposeMammalian expression of C terminally V5-tagged C11orf83/UQCC3DepositorAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSR21
Plasmid#69156Purposeread-outlox2272 mCherry to tagBFP switch for integration on ttTi14024, Chr XDepositorInsertsmCherry
TagBFP
UseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterrps-27Available SinceNov. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNS2_Ptrc::lasI
Plasmid#239008Purpose3OC12-HSL quorum sensing signal producer under Ptrc inducible promoterDepositorInsertAcyl-homoserine-lactone synthase, 3OC12-HSL
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceFeb. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pNS2_Ptrc::luxI
Plasmid#239010Purpose3OC6-HSL quorum sensing signal producer under Ptrc inducible promoterDepositorInsertAcyl-homoserine-lactone synthase, 3OC6-HSL
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceFeb. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAJC1
Plasmid#240164PurposeProduction of a thermostable enzyme, Pyrobaculum calidifontis manganese-dependent catalase, to be used in an educational laboratory exercise.DepositorInsertskatPc
Pc- kat
ExpressionBacterialPromoterT7Available SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPI159
Plasmid#207430PurposeExtrachromosomal expression for mNeonGreen Fusions N-terminalDepositorInsertN-terminal mNeonGreen
UseUnspecifiedAvailable SinceDec. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPI143
Plasmid#207427PurposeExtrachromosomal expression for mNeonGreen Fusions C-terminalDepositorInsertC-terminal mNeonGreen
UseUnspecifiedAvailable SinceDec. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB511-TP-UnaG-FLAG
Plasmid#203479PurposeFor Agrobacterium transformation. A plastid transit peptide fused UnaG-FLAG under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertPlastid transit peptide fused UnaG-FLAG
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB511-TP-tagRFP
Plasmid#203482PurposeFor Agrobacterium transformation. tagRFP flanked with an N-terminal plastid transit peptide and a C-terminal FLAG tag under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertTagRFP flanked with an N-terminal plastid transit peptide and a C-terminal FLAG tag.
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB560-NADK2
Plasmid#203760PurposeFor Agrobacterium transformation. tagRFP fused Arabidopsis thaliana NAD KINASE2 (NADK2) under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertNAD KINASE2
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMLS640
Plasmid#188892PurposettTi5605 MosSci targeting vector with Pmex-5::Cas9 and floxed Cbr-unc-119 markerDepositorInsertPmex-5::Cas9, Cbr-unc-119
ExpressionWormMutationC. elegans codom optimization and intron additionAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only