We narrowed to 29,031 results for: sta
-
Plasmid#131504PurposeEndogenous tagging of Tarpγ2/Stargazin: Intramolecular (amino acid position: S265)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pEGFP.mIKKα
Plasmid#74413PurposeExpresses mouse eGFP-IKKα in mammalian cellsDepositorAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) VOPP1
Plasmid#107507Purposeexpressing VOPP1, puromycin resistantDepositorAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-FAM58A
Plasmid#116739PurposeLentiviral expression of FAM58ADepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-NME7
Plasmid#23702DepositorInsertNME7 (NME7 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCRI001-pGEM-LS-Bar-PgpdA-dLbCas12a-VPR-Ttrpc-LS
Plasmid#140193PurposeChromosomal integration of PgpdA-dLbCas12a-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi integrative vector.DepositorInsertsdLbCas12a-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta), NLSMutationD832A DNAse deactivatedPromoterPgpdA and PtrpCAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) RALB
Plasmid#107506PurposeExpressing RALB, puromycin resistantDepositorAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-XRCC1-gRNA res-Neo
Plasmid#176149PurposeXRCC1 with dual PAM resistance to XRCC1 gRNA1 and XRCC1 gRNA2 & a neomycin/G418 resistance cassetteDepositorInsertX-ray repair cross complementing 1 (XRCC1 Human)
UseLentiviralExpressionMammalianMutationDual PAM resistance to XRCC1 gRNA 1 and XRCC1 gRN…PromoterCMVAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-NME5
Plasmid#23772DepositorInsertNME5 (NME5 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCR8-CDK12(sgR)
Plasmid#208346PurposeGateway cloning entry vector with CDK12 with sgRNA resistant silent mutations. Must be recombined into a DEST vector for expression.DepositorArticleInsertcyclin dependent kinase 12 (CDK12 Human)
UseGateway: entry vectorMutationSilent mutations in A88, K90, D92, R94, T715, S71…Available SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRCA378 - pBA904 Puro-T2A-GFP CD45 CRISPRa guide 3 (pRCA360 backbone)
Plasmid#238169PurposeLentiviral CRISPR guide vector expressing PTPRC targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
18065-M04-412
Plasmid#225667PurposeLentivirus protein expression. Control plasmid.DepositorInsertsUseLentiviralTags3xFLAGMutationC-terminally truncated (aa 1-333 only)PromoterWPRE-SV40p and mCMVpAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO shLYCHOS/LYCHOS WT-FLAG
Plasmid#209315PurposeLentiviral construct expressing shRNA against LYCHOS and LYCHOS WT-FLAG (resistant to shRNA)DepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-EGFL7-COMP5AP-AviTag-9xHis
Plasmid#157266PurposeMammalian expression of secreted protein fused to COMP5AP-AviTag-9xHis.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGK-Ldb3-mKate2
Plasmid#128766PurposeFluorescent mKate reporter for Ldb3DepositorAvailable SinceNov. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-GUCY2C-G549C
Plasmid#116407PurposeLentiviral expression of GUCY2C G549CDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) TSPAN9
Plasmid#107502PurposeExpresses TSPAN9, puromycin resistantDepositorAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only