We narrowed to 46,051 results for: TRO
-
Plasmid#227004PurposeAAV transfer plasmid encoding the human A53T mutant α-SYN under the control of the CMVie enhanced synapsin1 promoterDepositorInsertalpha synuclein A53T mutant (SNCA Synthetic, Human)
UseAAVMutationA53TPromoterCMVenh synapsinAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
PP_071_pAAV_CAG_DIO-LR-Voltron2-P2A-LR-CheRiff-TS-eYFP-ER2
Plasmid#203229PurposeCre-dependent version of PP_070. Co-expressing membrane-localized Voltron2 and membrane-localized CheRiff.DepositorInsertCre-dependent, membrane-localized Optopatch
UseAAVExpressionMammalianPromoterCAGAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-mPGK-eGFP (beta-globin intron)
Plasmid#162513PurposeAAV vector plasmid expressing enhanced green fluorescent protein (eGFP) under the mouse phosphoglycerate kinase (mPGK) promoter that is upstream of a beta-globin intronDepositorInserteGFP
UseAAVExpressionMammalianPromotermPGKAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.Control
Plasmid#128749PurposeExpresses control gRNADepositorInsertControl sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRS9 (HIF2a-pRetro-Super)
Plasmid#22101DepositorInsertsynthethic oligonucleotide
UseRNAi and RetroviralExpressionMammalianMutationsynthethic oligonucleotide encoding shRNA targeti…Available SinceOct. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSuper.Retro.Puro-WDR5 shRNA 2
Plasmid#59975PurposeKnockdown of WDR5DepositorInsertWDR5 shRNA
UseRetroviralAvailable SinceOct. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2(mScarlet-FLAG) matched positive control in pTwist-CMV
Plasmid#216156PurposeExpresses mScarlet regardless of TDP-43 knockdown. Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertmScarlet with C-terminal FLAG tag
ExpressionMammalianAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn Con/Fon EYFP (AAV Retrograde)
Viral Prep#55650-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-hSyn Con/Fon EYFP (#55650). In addition to the viral particles, you will also receive purified pAAV-hSyn Con/Fon EYFP plasmid DNA. Synapsin driven, Cre and Flp-dependent EYFP expression. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEYFP (Cre- and Flp-dependent)Available SinceSept. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-ChR2-mCherry-Fishell-3 (AAV Retrograde)
Viral Prep#83898-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-mDlx-ChR2-mCherry-Fishell-3 (#83898). In addition to the viral particles, you will also receive purified pAAV-mDlx-ChR2-mCherry-Fishell-3 plasmid DNA. mDlx-driven expression of ChR2 fused to mCherry. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxTagsmCherryAvailable SinceMarch 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001487130)
Plasmid#80262Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRetro-CAG-DsRedExpress-TVA
Plasmid#235699PurposeControl plasmid expressing TVA and DsRed without G proteinDepositorInsertDsRedExpress, TVA800
UseRetroviralPromoterCAGAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNAintron-CHIKV-Structural polyprotein
Plasmid#215698PurposeProduces the Chikungunya virus structural polyprotein Capsid-E3-E2-6K-E1DepositorInsertCHIKV structural polyprotein Capsid-E3-E2-6K-E1
ExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Pet15b-Endosomal Escape Control
Plasmid#186552PurposeNegative Control confirming the need for a CPP peptide in mediating internalizationDepositorInsert6H-ETA-GFP
Tags6xHis and EGFPExpressionBacterialPromoterT7Available SinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
BCL6-GFP (1-275AA) in Cilantro
Plasmid#169932PurposeOverexpression of 1-275AA BCL6-GFP fusionDepositorAvailable SinceJuly 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2214 - Intron GG1 - 900 bp
Plasmid#159880PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG1 - 900 bp
ExpressionWormMutationNot applicableAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1359 - Intron GG2 - smu-1
Plasmid#159805PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG2 - smu-1
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-shNup133-1
Plasmid#87334PurposeTo express shRNA against human Nup133DepositorInsertshRNA against human Nup133
UseRNAiExpressionMammalianPromoterH1Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-shNup133-2
Plasmid#87333PurposeTo express shRNA against human Nup133DepositorInsertshRNA against human Nup133
UseRNAiExpressionMammalianPromoterH1Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-BPTF-sh27
Plasmid#73668PurposepSIREN-RetroQ vector containing shRNA sequence to BPTFDepositorAvailable SinceApril 13, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits