We narrowed to 9,373 results for: Pol
-
Plasmid#160808PurposeExpress ISC mutant POLA1DepositorInsertPOLA1 ISCmut (POLA1 Human)
UseRetroviralMutationCodon optimized, C1354S, C1359S, C1377S, C1380SAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-3_PolyU(1)_Tornado-Corn
Plasmid#159503PurposeTests for the impact of 1 uracil in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-3_PolyU(1)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-2_PolyU(7)_Tornado-Corn
Plasmid#159493PurposeTests for the impact of 7 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-2_PolyU(7)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-2_PolyU(4)_Tornado-Corn
Plasmid#159490PurposeTests for the impact of 4 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-2_PolyU(4)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-2_PolyU(2)_Tornado-Corn
Plasmid#159488PurposeTests for the impact of 2 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-2_PolyU(2)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-1_PolyU(4)_Tornado-Corn
Plasmid#159482PurposeTests for the impact of 4 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-1_PolyU(4)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-1_PolyU(5)_Tornado-Corn
Plasmid#159483PurposeTests for the impact of 5 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-1_PolyU(5)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-1_PolyU(6)_Tornado-Corn
Plasmid#159484PurposeTests for the impact of 6 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-1_PolyU(6)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-1_PolyU(7)_Tornado-Corn
Plasmid#159485PurposeTests for the impact of 7 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-1_PolyU(7)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-1_PolyU(8)_Tornado-Corn
Plasmid#159486PurposeTests for the impact of 8 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-1_PolyU(8)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
KZ101: pMVP (L3-L2) P2A-eCFP + polyA
Plasmid#121768PurposepMVP L3-L2 entry plasmid, contains eCFP-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eCFP linked by P2A to gene of interest.DepositorInsertP2A-eCFP + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ301: pMVP (L3-L2) P2A-Blast + polyA
Plasmid#121779PurposepMVP L3-L2 entry plasmid, contains Blast-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Blast selection marker linked by P2A to gene of interest.DepositorInsertP2A-Blast + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ201: pMVP (L3-L2) P2A-Hygro + polyA
Plasmid#121782PurposepMVP L3-L2 entry plasmid, contains Hygro-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Hygro selection marker linked by P2A to gene of interest.DepositorInsertP2A-Hygro + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KG901: pMVP (L3-L2) HA epitope tag + polyA
Plasmid#121749PurposepMVP L3-L2 entry plasmid, contains HA epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertHA epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
YIp128-P30-His-pol30(K127R)
Plasmid#99543PurposeYeast integrative vector for expression of His-tagged POL30 (PCNA) mutant K127R; Leu2 markerDepositorAvailable SinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
attB-GFP-Dnmt3b6-Poly(A)-NeoR
Plasmid#65552PurposePlasmid for Bxb1-mediated recombination of the GFP-Dnmt3b6 cDNA into a MIN-tagged locus using Neomycin selectionDepositorInsertDnmt3b (Dnmt3b Mouse)
UseMouse Targeting; Bxb1TagsGFPExpressionMammalianMutationisoform 6Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-CasRX-P2A-EGFP-BGH PolyA
Plasmid#154004PurposeExpress CasRxDepositorInsertCasRx
UseCRISPRPromoterCAGAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGP-CAG-iGABASnFR2-WPRE-bGH-polyA
Plasmid#218868PurposeMammalian expression of improved GABA sensor (positive change in fluorescence)DepositorInsertiGABASnFR2
ExpressionMammalianMutationS99A F102Y F104Y L178SPromoterCAGAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1(Hygro) myc-hPolQ-Flag
Plasmid#73132PurposeTo express in mammalian cells human PolQDepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only