We narrowed to 1,566 results for: aav vector plasmid
-
Plasmid#203540PurposeSaCas9 expression in astrocytesDepositorInsertSaCas9
UseAAVExpressionMammalianAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV CB6 FFLuc-miR122
Plasmid#35656DepositorAvailable SinceApril 26, 2012AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1a-DIO-oChIEF(E163A/T199C)-P2A-dTomato-WPRE-BGHpA
Plasmid#51094PurposeCre dependent expression of oChIEF kinetic variant E163A/T199C with physically uncoupled dTomato fluorophoreDepositorInsertoChIEF(E163A/T199C)
UseAAVTagsP2A-dTomatoExpressionMammalianMutationE163A/T199CPromoterEF1aAvailable SinceMay 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1a-DIO-ChIEF(E162A/T198C)-P2A-dTomato-WPRE-BGHpA
Plasmid#51095PurposeCre dependent expression of ChIEF kinetic variant E162A/T198C with physically uncoupled dTomato fluorophoreDepositorInsertChIEF(E162A/T198C)
UseAAVTagsP2A-dTomatoExpressionMammalianMutationE162A/T198CPromoterEF1aAvailable SinceMay 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hIBA1a-GFP-miR124T
Plasmid#214147PurposeAAV vector to restrict GFP expression in microglia.DepositorHas ServiceAAV5InsertGFP
UseAAVAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-jAspSnFR3-mRuby3
Plasmid#203459PurposejAspSnFR3-mRuby3 in adenoviral expression vectorDepositorInsertjAspSnFR3
UseAAV and AdenoviralTagsHis-tag and mRuby3ExpressionMammalianPromoterCAGAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVf-EnhCB-lacZnls miR-122 3x
Plasmid#35644DepositorInsert3 miR-122 target sites
UseAAVPromoterCBAvailable SinceApril 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
AAV_pMBP-dnVamp2-P2AT2A-EGFP-caax
Plasmid#190153PurposeExpresses dominant-negative Vamp2 (mouse Vamp2 AA 1-94) plus membrane-targeted EGFP in oligodendrocytes; AAV vectorDepositorInsertVamp2 (Vamp2 Mouse)
UseAAVTagsP2AT2A-EGFP-caaxExpressionMammalianMutationTruncation that includes only AA #1-94PromoterMBPAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-hDLXI56i-minBG-CI-EGFP-W3SL-BC(p1-10)
Plasmid#231360PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from the minBG promoter with hDLXI56i enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-mscRE4-minBG-CI-EGFP-W3SL-BC(p1-10)
Plasmid#231361PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from the minBG promoter with mscRE4 enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-CMVe-SCP1-TagBFP2-W3SL-BC(p1-10)
Plasmid#231354PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses TagBFP from SCP1 promoter and CMV enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG-NLS-EGFP-WPRE-SV40pA-T7-T3-BC(p1-14)
Plasmid#231345PurposeSingle stranded AAV genome with components for tracking AAV genome via AAV-Zombie. Also expresses a nuclear localized EGFP from CAG promoter.DepositorInsertT7/T3-BC(p1-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-DjCas13d-P2A-mCherry-pA
Plasmid#233027PurposeTo Express HA tagged DjCas13d and mcherry from the mammalian EFS promoter. The DjCas13dx and mCherry are separated by a P2A siteDepositorInsertDjCas13d/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-P2A-mCherry-pA
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-hfCas13d-P2A-mCherry-pA
Plasmid#233026PurposeTo Express HA Tagged hfCas13d and mcherry from the mammalian EFS promoter. The hfCas13d and mCherry are separated by a P2A siteDepositorInserthfCas13d/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV_pMBP-dnVamp3-P2AT2A-EGFP-caax
Plasmid#190154PurposeExpresses dominant-negative Vamp3 (rat Vamp3 AA 1-81) plus membrane-targeted EGFP in oligodendrocytes; AAV vectorDepositorInsertVamp3 (Vamp2 Rat)
UseAAVTagsP2AT2A-EGFP-caaxExpressionMammalianMutationTruncation that includes only rat Vamp3 AA #1-81PromoterMBPAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pK170.AAV-TRE-Cre-WPRE (Supernova)
Plasmid#85040PurposeFor AAV-TRE-Cre based Supernova, pK170 should be used with pK168 etc.DepositorInsertnlsCre-WPRE
UseAAVExpressionMammalianAvailable SinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-GfaABC1D-lck-smV5-4x6T-WPRE
Plasmid#196416PurposeAstrocytic expression of membrane-targeted V5 spaghetti monster reporter in AAV; astrocyte specificity enhanced with 4x6T miRNA targeting cassetteDepositorInsertLck-smV5
UseAAV; Astrocyte-selectiveTagsLckExpressionMammalianPromoterCAG and GfaABC1DAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-GfaABC1D-lck-smMyc-4x6T-WPRE
Plasmid#196415PurposeAstrocytic expression of membrane-targeted Myc spaghetti monster reporter in AAV; astrocyte specificity enhanced with 4x6T miRNA targeting cassetteDepositorInsertLck-smMyc
UseAAV; Astrocyte-selectiveTagsLckExpressionMammalianPromoterCAG and GfaABC1DAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only