We narrowed to 14,481 results for: cas9
-
Plasmid#48655PurposeBacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAP608-1
Plasmid#99484PurposeH2B::linker::GFP (contain 3 introns)::3XFlag::TEV::Myc::tbb-2 3UTRDepositorInsertH2B::linker::GFP with introns::3XFlag::TEV::Myc::tbb-2 3UTR
ExpressionBacterialAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TB
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TB
Plasmid#48652PurposeBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDD401
Plasmid#91828PurposePmyo-2::GFP FP-slot donor for the SapTrap cloning systemDepositorInsertPmyo-2::GFP
UseCRISPRExpressionWormMutationNucleotide 489 of the myo-2 promoter was changed …Available SinceJune 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJA14
Plasmid#59929PurposegRNA for cleavage at rde-1(H974) locus in C elegansDepositorInsertrde-1(H974) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TA
Plasmid#48649PurposeBacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-B
Plasmid#48662PurposeBacterial ST1 repression YFP reporter: protospacer BDepositorInsertST1 prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-sbcB-N
Plasmid#220305PurposeGateway entry plasmid (attL1& attR5) expressing sbcB exonuclease fused to the N-terminus of zSpCas9, connected by a flexible XTEN linker, without promoterDepositorInsertsbcB-XTEN linker-zSpCas9
UseCRISPR; Gateway compatible sbcb-xten linker- zspc…ExpressionPlantAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-TREX2-N
Plasmid#244025PurposeGateway entry plasmid (attL1& attR5) expressing TREX2 exonuclease fused to the N-terminus of LbCas12a, connected by a flexible XTEN linker, without promoterDepositorInsertCas12a
UseCRISPRTagsTREX2Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-AtEXO1B-N
Plasmid#244024PurposeGateway entry plasmid (attL1& attR5) expressing AtEXO1B exonuclease fused to the N-terminus of LbCas12a, connected by a flexible XTEN linker, without promoterDepositorInsertCas12a
UseCRISPRTagsAtEXO1BAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGMF6
Plasmid#242208Purpose35Sp::eGFP:35St cassette in L1 vector backbone. Expresses a nuclear localized eGFP protein for transient plant transformation.DepositorInsertLevel1 35Sp::eGFP:35St
UseSynthetic BiologyExpressionPlantAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMB109
Plasmid#223017PurposeCas9 and Csy4 with 5' and 3' targets (II) for Lotus callus assayDepositorInsertCas9 and Csy4 with 5' and 3' targets (II)
UseCRISPRExpressionPlantAvailable SinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMB105
Plasmid#223016PurposeCas9 and Csy4 with 5' and 3' targets (I) for Nicotiana leaf assayDepositorInsertCas9 and Csy4 with 5' and 3' targets (I)
UseCRISPRExpressionPlantAvailable SinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_268
Plasmid#231112PurposeSpG-Cas9DepositorInsertCas9-SpG
UseCRISPR and LentiviralAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Afp
Plasmid#99696PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Afp, vector allows for strong activation of mouse Afp, can be packaged and delivered as AAVDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCL194
Plasmid#222225PurposeExpresses site 1/Cas9/Eco1 RT in HIS3 locus.DepositorInsertsite 1/Cas9/Eco1 RT
UseCRISPRExpressionYeastAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCL195
Plasmid#222226PurposeExpresses site 2/Cas9/Eco1 RT in HIS3 locus.DepositorInsertsite 2/Cas9/Eco1 RT
UseCRISPRExpressionYeastAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCL368
Plasmid#222227PurposeExpresses site 3/Cas9/Eco1 RT in HIS3 locus.DepositorInsertsite 3/Cas9/Eco1 RT
UseCRISPRExpressionYeastAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only