We narrowed to 25,285 results for: crispr
-
Plasmid#134844PurposeAll in one overexpression of CasRx and guideRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRfxCas13d
UseCRISPRTagsT2A mCherryExpressionMammalianPromoterCAGAvailable sinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiBE3-SpRY-Blast
Plasmid#199303PurposeExpresses SpRY Cas9 nickase cytosine base editor FNLS-BE3 and blasticidin resistanceDepositorInsertFNLS-BE3-SpRY
UseCRISPR and LentiviralTags2A tagExpressionMammalianPromoterEFSAvailable sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pREDIT_Cas9-MS2-BB_BbsI
Plasmid#164802PurposeREDIT backbone for wildtype Cas9, pU6-MS2-gRNA-backbone(BbsI)-CBH-SpCas9-T2A-EBFPDepositorTypeEmpty backboneExpressionMammalianAvailable sinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCas9–mKate2ps–T1gRNA
Plasmid#62717Purposet1 gRNA (ATGAGAATCAAGGCGGTCGA)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9–mKate2ps
ExpressionMammalianAvailable sinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJAT10
Plasmid#204293PurposeFor marking CRISPR HDR integrant with DsRed expressed in flight muscles.DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMHC-DsRed
UseCRISPRPromoterMHCAvailable sinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_RAD21
Plasmid#64056PurposeHomology Arms and 3X Flag with P2A Neo for 3' tagging of human RAD21DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRAD21 Homology Arms (RAD21 Human)
Tags3X Flag P2A NeoAvailable sinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLinker-6xHA-HXGPRT-LoxP
Plasmid#86552PurposeThe plasmid is used for endogenous tagging using CRISPR technology in ToxoplasmaDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLinker-6xHA-HGPRT-LoxP
UseExpression in toxoplasma gondiiAvailable sinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
FU_tetO_dCas9-VP192-T2A-EGFP
Plasmid#121173PurposeLentiviral construct for inducible expression of dCas9-VP192 transcriptional activator and EGFP.DepositorInsertdCas9-VP192-T2A-EGFP
UseCRISPR and Lentiviral; Inducible by doxycyclineTagsT2A-EGFP-ires-puroExpressionMammalianAvailable sinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLinker-BirA-3xHA-HXGPRT-loxP
Plasmid#86668Purposefor generation of BirA tagged strains using CRISPR tagging technologyDepositorInsertLinker-BirA-3xHA-HXGPRT 3'UTR
ExpressionBacterialAvailable sinceMay 4, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pdCas9-M-3A2
Plasmid#73435PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3A2.DepositorInsertRepressor 3A2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX551-miniCMV-CjCas9
Plasmid#107033PurposeAAV plasmid expressing CjCas9 under control of miniCMV promoterDepositorInsertCjCas9
UseAAV and CRISPRExpressionMammalianAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHEE-R-hyg9si
Plasmid#222832PurposeCRISPR/Cas9 for multi-gene knockout in Arabidopsis (single intron-containing Cas9, EC1 promoter, hygromycin and red fluorescent seed selection)DepositorTypeEmpty backboneUseCRISPRAvailable sinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
p(U6a-BsaI-gRNA)
Plasmid#65955PurposeTribolium U6a promoter with BsaI cloning site to insert guide RNA sequenceDepositorTypeEmpty backboneExpressionInsectPromoterU6Available sinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBS-KS-attB1-2-PT-SA-SD-2-2xTY1-V5
Plasmid#61257PurposeCRISPR-RMCE, second step attB plasmid, intron phase 2, exchange dsRed with 2xTY1 and V5 tags cassetteDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsert2xTY1-V5
UseCRISPRTagsTY1 and V5Available sinceNov. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEL031
Plasmid#137900PurposeSTU2.0 SpyCas9 tRNA system for plant genome editingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable sinceFeb. 25, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
TBG-Vector
Plasmid#109396PurposeAAV-CRISPR knockout plasmid with Cre recombinase driven by TBG promoter for direct in vivo genome editing in mouse liverDepositorTypeEmpty backboneUseAAV, CRISPR, Mouse Targeting, and Synthetic Biolo…ExpressionMammalianPromoterTBGAvailable sinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_SSRP1
Plasmid#72370PurposeDonor vector for 3' FLAG tag of human SSRP1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSSRP1 Homology Arms (SSRP1 Human)
UseCRISPRTags3XFLAG-P2A-NeoRAvailable sinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pADH100
Plasmid#90980PurposeNAT-marked "empty" gRNA expression construct; part 2 of 2 of C.alb HIS1-FLP CRISPR system. Use with pADH99 CAS9 expression construct.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNAT 2 of 2, pSNR52, empty gRNA, gRNA conserved, FRT, DS_HIS1
UseCRISPRAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p2CT-His-MBP-Lbu_C2c2_R1079A
Plasmid#83494PurposeBacterial expression of L. buccalis C2c2 CRISPR effector (R1079A- pre-crRNA processing mutant)DepositorInsertLbu_C2c2_R1079A
UseCRISPRTagsHis6-MBPExpressionBacterialMutationR1079APromoterT7Available sinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
D. vulgaris Cascade/I-C (Cas5c-Cas8c-Cas7)/pHMGWA
Plasmid#81185PurposeExpresses Desulfovibrio vulgaris Cascade/I-C complex subunits in E. coli with TEV-cleavable N-terminal His-MBP tag on Cas5cDepositorInsertsCas5c
Cas8c
Cas7
UseCRISPRTags6xHis - MBP - TEV protease siteExpressionBacterialPromoterT7Available sinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only