We narrowed to 32,698 results for: LIS;
-
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJ207 Delta-cpc-KanR
Plasmid#51468PurposeDeletes the cpc operon in Synechocystis and confers kanamycin resistanceDepositorInsertReplacing the cpc operon with kanamycin resistance
UseSynthetic BiologyPromoterSynechocystis endogenous cpc-operon promoterAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTH862-CEN-slowmaxRLuc/minCFLuc
Plasmid#115371PurposeExpresses translation initiation-controlled Renilla luciferase and translation elongation-controlled firefly luciferaseDepositorInsertsFirefly Luciferase (codon minimised)
Gcn4 5'-UTR + Renilla luciferase (codon optimised)
ExpressionYeastMutationAll codons have been changed for the most favoura…PromoterADH1 and TDH3Available SinceJune 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
0_T7-mScarlet3
Plasmid#225927PurposeIn vitro synthesis of mRNA for fluorescent protein mScarlet3 (control)DepositorInsertmScarlet3
UseIn vitro transcriptionPromoterT7Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8m-WPRE (AAV1)
Viral Prep#162375-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-jGCaMP8m-WPRE (#162375). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8m-WPRE plasmid DNA. Syn-driven expression of calcium sensor GCaMP8m (faster, more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8s-WPRE (AAV9)
Viral Prep#162374-AAV9PurposeReady-to-use AAV9 particles produced from pGP-AAV-syn-jGCaMP8s-WPRE (#162374). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8s-WPRE plasmid DNA. Syn-driven expression of calcium sensor GCaMP8s (more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8s-WPRE (AAV1)
Viral Prep#162374-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-jGCaMP8s-WPRE (#162374). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8s-WPRE plasmid DNA. Syn-driven expression of calcium sensor GCaMP8s (more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8m-WPRE (AAV9)
Viral Prep#162375-AAV9PurposeReady-to-use AAV9 particles produced from pGP-AAV-syn-jGCaMP8m-WPRE (#162375). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8m-WPRE plasmid DNA. Syn-driven expression of calcium sensor GCaMP8m (faster, more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8f-WPRE (AAV1)
Viral Prep#162376-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-jGCaMP8f-WPRE (#162376). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8f-WPRE plasmid DNA. Syn-driven expression of ultrafast calcium sensor GCaMP8f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8f-WPRE (AAV5)
Viral Prep#162376-AAV5PurposeReady-to-use AAV5 particles produced from pGP-AAV-syn-jGCaMP8f-WPRE (#162376). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8f-WPRE plasmid DNA. Syn-driven expression of ultrafast calcium sensor GCaMP8f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8f-WPRE (AAV9)
Viral Prep#162376-AAV9PurposeReady-to-use AAV9 particles produced from pGP-AAV-syn-jGCaMP8f-WPRE (#162376). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8f-WPRE plasmid DNA. Syn-driven expression of ultrafast calcium sensor GCaMP8f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8m-WPRE (AAV5)
Viral Prep#162375-AAV5PurposeReady-to-use AAV5 particles produced from pGP-AAV-syn-jGCaMP8m-WPRE (#162375). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8m-WPRE plasmid DNA. Syn-driven expression of calcium sensor GCaMP8m (faster, more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.Ruby2sm-Flag.WPRE.SV40 (AAV1)
Viral Prep#98928-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.CAG.Flex.Ruby2sm-Flag.WPRE.SV40 (#98928). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.Ruby2sm-Flag.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent expression of Ruby2sm-Flag spaghetti monster construct. Spaghetti monster constructs are not fluorescent ("dark") to allow full range of antibody staining. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsmRuby2sm-Flag (spaghetti monster construct)Available SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 (AAV1)
Viral Prep#98927-AAV1PurposeReady-to-use AAV1 particles produced from pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 (#98927). In addition to the viral particles, you will also receive purified pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent expression of GFPsm_myc spaghetti monster construct. Spaghetti monster constructs are not fluorescent ("dark") to allow full range of antibody staining. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFPsm-myc (spaghetti monster construct)Available SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8s-WPRE (AAV5)
Viral Prep#162374-AAV5PurposeReady-to-use AAV5 particles produced from pGP-AAV-syn-jGCaMP8s-WPRE (#162374). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8s-WPRE plasmid DNA. Syn-driven expression of calcium sensor GCaMP8s (more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.Ruby2sm-Flag.WPRE.SV40 (AAV5)
Viral Prep#98928-AAV5PurposeReady-to-use AAV5 particles produced from pAAV.CAG.Flex.Ruby2sm-Flag.WPRE.SV40 (#98928). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.Ruby2sm-Flag.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent expression of Ruby2sm-Flag spaghetti monster construct. Spaghetti monster constructs are not fluorescent ("dark") to allow full range of antibody staining. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsmRuby2sm-Flag (spaghetti monster construct)Available SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
MtPT4-p3
Plasmid#160003PurposeMultigene construct containing the betalain pigment biosynthetic genes under the control of the MtPT4 promoter for visualisation of arbuscular mycorrhizal colonisation in Medicago truncatula roots.DepositorInsertsDsRed (reverse orientation)
DODAα1
CYP76AD1
cDOPA5GT
ExpressionPlantPromoterArabidopsis thaliana Ubiquitin 10 Promoter (AtUb1…Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
10_T7-SP-CD8tm-mScarlet3
Plasmid#225937PurposeIn vitro synthesis of mRNA for fluorescent protein mScarlet3 tagged with a signal peptide and the CD8 transmembrane domainDepositorInsertSP-CD8tm-mScarlet3
UseIn vitro transcriptionPromoterT7Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
11_T7-SP-mScarlet3-GPI
Plasmid#229806PurposeIn vitro synthesis of mRNA for fluorescent protein mScarlet3 tagged with a signal peptide and a GPI attachment siteDepositorInsertSP-mScarlet3-GPI
UseIn vitro transcriptionMutationT7 promoterAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCri System
Plasmid Kit#1000000058PurposePlasmids used for cytoplasmic and periplasmic/extracellular heterologous protein expression in E. coli, Bacillus subtilis, and Pichia pastoris.DepositorApplicationGene Expression and LabelingVector TypeBacterial Expression, Yeast ExpressionAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
ScEnSor Kit
Plasmid Kit#1000000215PurposeTo investigate the intracellular environment of Saccharomyces cerevisiae with a variety of biosensors.DepositorApplicationGene Expression and LabelingVector TypeYeast ExpressionAvailable SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
NbPT5b-p3
Plasmid#160001PurposeMultigene construct containing the betalain pigment biosynthetic genes under the control of the NbPT5b promoter for visualisation of arbuscular mycorrhizal colonisation in Nicotiana benthamiana roots.DepositorInsertsBar (reverse orientation)
DODAα1
CYP76AD1
cDOPA5GT
ExpressionPlantPromoterAgrobacterium tumefaciens Nopaline synthase Promo…Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
NbBCP1b-p3
Plasmid#160002PurposeMultigene construct containing the betalain pigment biosynthetic genes under the control of the NbBCP1b promoter for visualisation of arbuscular mycorrhizal colonisation in Nicotiana benthamiana rootsDepositorInsertsBar (reverse orientation)
DODAα1
CYP76AD1
cDOPA5GT
ExpressionPlantPromoterAgrobacterium tumefaciens Nopaline synthase Promo…Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET15-ZmPYK
Plasmid#220230PurposeInducible expression of Zymomonas mobilis pyruvate kinaseDepositorTags6xHis-TEVExpressionBacterialPromoterT7Available SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-KIF1B beta-FL
Plasmid#79108PurposeMammalian expression of GFP-KIF1B beta-FLDepositorInsertGFP-KIF1B beta full length (KIF1B Human)
TagsGFPExpressionMammalianMutationexon 25 missing (natural splice varient)PromoterCMVAvailable SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
RFP-KIF1B beta-FL
Plasmid#79111PurposeMammalian expression of RFP-KIF1B beta-FLDepositorInsertRFP-KIF1B beta full length (KIF1B Human)
TagsRFPExpressionMammalianMutationexon 25 missing (natural splice varient)PromoterCMVAvailable SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
GFP-KIF1B beta-600-1400
Plasmid#79109PurposeMammalian expression of GFP-KIF1B beta-600-1400DepositorInsertGFP-KIF1B beta (600-1400 amino acids) (KIF1B Human)
TagsGFPExpressionMammalianMutationexon 25 missing (natural splice varient)PromoterCMVAvailable SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
Yeast GPCR-sensor Toolkit
Plasmid Kit#1000000157PurposeThis toolkit includes plasmids for constructing highly-tunable GPCR-based biosensors in yeast.DepositorApplicationCloning and Synthetic Biology, Gene Expression and LabelingVector TypeYeast ExpressionCloning TypeGolden Gate (MoClo)Available SinceOct. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGCC4
Plasmid#37058DepositorTypeEmpty backboneAvailable SinceJune 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGCC5
Plasmid#37059DepositorTypeEmpty backboneAvailable SinceMay 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA (New MCS)
Plasmid#32530DepositorTypeEmpty backboneTagsHAExpressionMammalianAvailable SinceSept. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
Flag-WASP
Plasmid#47432DepositorInsertWASP
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
Endophilin II Full
Plasmid#47409DepositorInsertEndophilin II
TagsGSTExpressionBacterialPromotertacAvailable SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pSrTA1662-toolkit
Plasmid#154372PurposeExpresses SrTA1662 in plantsDepositorInsertSrTA1662
ExpressionBacterial and PlantPromoterNative promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -