We narrowed to 12,273 results for: shRNA
-
Plasmid#250237PurposeCre-dependent AAV expressing mCherry and a scrambled shRNA under EF1α promoter. Used as a non-targeting control for shRNA knockdownDepositorInsertshRNA-Scramble (SMARCA4 Synthetic)
UseAAV, Cre/Lox, Mouse Targeting, RNAi, and Syntheti…ExpressionMammalianPromoterEF1αAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaAnillin homology domain
Plasmid#187277PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Anillin homology domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaAnillin homology domainPromoterU6, CMVAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1_1-1605-del1079-1110-RNFtoAAA-shRNAres_W
Plasmid#147886PurposeMammalian Expression of HsNot1iso1_1-1605-del1097-1110-RNFtoAAA-shRNAresDepositorInsertHsNot1iso1_1-1605-del1097-1110-RNFtoAAA-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation compared to the sequence of iso…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1_1-1605-del1097-1110-RNFIKGRQtoAAADSYAA-shRNAres_W
Plasmid#147887PurposeMammalian Expression of HsNot1iso1_1-1605-del1097-1110-RNFIKGRQtoAAADSYAA-shRNAresDepositorInsertHsNot1iso1_1-1605-del1097-1110-RNFIKGRQtoAAADSYAA-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation compared to the sequence of iso…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1535 pscAAV mU6 shRNA(scram) CMV-IE Nuc-EYFP
Plasmid#135563PurposeAn AAV vector expressing scrambled shRNA and a nuclear EYFP reporterDepositorInsertsshRNA (scrambled)
Nuc-EYFP
UseAAV and RNAiTags3xNLSExpressionMammalianPromoterCMV-IE and mU6Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
Antibody#188878-rAbPurposeAnti-Giantin recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunocytochemistryReactivityHumanSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceMarch 27, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#199193-rAbPurposeAnti-Giantin chimeric recombinant antibody. The hybridoma-derived heavy chain variable sequence and kappa light chain are fused to a rabbit IgG Fc.DepositorRecommended ApplicationsImmunocytochemistryReactivityHumanSource SpeciesRabbitIsotypeIgGTrial SizeAvailable to purchaseAvailable SinceApril 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#207115-rAbPurposeAnti-Beta-2-microglobulin [BBM.1] (Human) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunocytochemistryReactivityHumanSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceNov. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Multiple Lentiviral Expression (MuLE) system
Plasmid Kit#1000000060PurposeA plasmid toolbox used to construct vectors for constitutive or inducible gene expression, knockdown, deletion or editing.DepositorApplicationCloning and Synthetic BiologyVector TypeLentiviral, Mammalian ExpressionCloning TypeMultiSite GatewayAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE (AAV5)
Viral Prep#125712-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE (#125712). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE plasmid DNA. CaMKIIa-driven expression of the optimized mosquito OPN3 rhodopsin in-frame with mScarlet. These AAV preparations are suitable purity for injection into animals.DepositorPromotershort version of αCamKinase II promoter (0.4kb)TagsmScarletAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE (AAV1)
Viral Prep#125712-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE (#125712). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE plasmid DNA. CaMKIIa-driven expression of the optimized mosquito OPN3 rhodopsin in-frame with mScarlet. These AAV preparations are suitable purity for injection into animals.DepositorPromotershort version of αCamKinase II promoter (0.4kb)TagsmScarletAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE (AAV Retrograde)
Viral Prep#125712-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE (#125712). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE plasmid DNA. CaMKIIa-driven expression of the optimized mosquito OPN3 rhodopsin in-frame with mScarlet. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromotershort version of αCamKinase II promoter (0.4kb)Available SinceJan. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-BPTF-sh28
Plasmid#73669PurposepSIREN-RetroQ vector containing shRNA sequence to BPTFDepositorAvailable SinceMarch 22, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSIREN-RetroQ-BPTF-sh27
Plasmid#73668PurposepSIREN-RetroQ vector containing shRNA sequence to BPTFDepositorAvailable SinceApril 13, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSicoR p53
Plasmid#12090PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both EGFP and shRNA to be recombined out of the construct, turning OFF p53 shRNA expression.DepositorInsertp53 shRNA (Trp53 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianMutationEGFP is expressed from this plasmid as a marker, …Available SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSLIK sh human Rb 1534 hyg
Plasmid#31500DepositorInsertRB shRNA (RB1 Human)
UseLentiviral and RNAiTagsEGFPExpressionMammalianMutationThe target sequence for shRB 1534 is GAACGATTATCC…Available SinceAug. 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSicoR Dnmt1
Plasmid#12166PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both EGFP and shRNA to be recombined out of the construct, turning OFF Dnmt1 shRNA expression.DepositorInsertDnmt1 shRNA (Dnmt1 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianMutationEGFP is expressed from this plasmid as a marker, …Available SinceJune 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
Banshee shRandom mCherry
Plasmid#80145Purposeretroviral expression of random shRNADepositorInsertrandom shRNA
UseRetroviralExpressionMammalianAvailable SinceJuly 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
FH95pUp95GW (B4)
Plasmid#74013Purposelentiviral expression of shRNA resistant Psd95-alpha-EGFP fusion and Psd95 shRNADepositorInsertPsd95 shRNA
UseLentiviral and RNAiExpressionMammalianPromoterH1Available SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1A
Plasmid#185382PurposeFor mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1ADepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only