We narrowed to 8,454 results for: gnal
-
Plasmid#112086PurposeBacterial expression plasmid containing His and MBP tags for 3 PRM motif repeats of Human Abl.DepositorInsertAbl-PRM-3R (ABL1 Human)
TagsHis-6 and MBPExpressionBacterialMutationconstruct contains only the PRM motif of Abl1PromoterLacAvailable SinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
ACO2_pLX307
Plasmid#98312PurposeLentiviral expression of ACO2DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-H2B-iRFP670-p2a-mCerulean-Cdt1 (1-100)-IRES-puromycin
Plasmid#223965PurposeDual fluorescent reporter for histone H2B and for Cdt1DepositorUseLentiviralTagsiRFP670 and mCeruleanExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mTagBFP2-CAAX2 WPRE
Plasmid#236231PurposeAAV expression of a fluorescent marker, mTagBFP2, fused to the plasma membrane targeting sequence CAAX2DepositorInsertmTagBFP2 fused to the plasma membrane targeting sequence CAAX2
UseAAVTagsmTagBFP2Promoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSH1/M-FGFR1-Fv-Fvls-E
Plasmid#15285DepositorInsertFGFR1 kinase, FKBP12v36 (Fgfr1 Mouse)
TagsHA epitope and Myristoylation-targeting domain c-…ExpressionMammalianMutationFGFR1 cytoplasmic domain FKBP12 F36VAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-FoxO1_1R_10A_3D
Plasmid#106278PurposeFluorescent fusion protein for FoxO1DepositorInsertsTagsClover fluorescent proteinExpressionMammalianMutationDeleted amino acids 401-636, S209A, H212R, S215A,…PromoterEF1a/RPBSAAvailable SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMSCV_FLT3
Plasmid#223566PurposeThe plasmid is expressed FLT3 in mammalian cells.DepositorAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER22-MKK6E-Flag
Plasmid#99259PurposeLentiviral vector encoding a doxycycline-inducible Flag-tagged constitutively active MKK6.DepositorInsertMKK6E (MAP2K6 Human)
UseLentiviralTagsFlagExpressionMammalianMutationS207E T211EPromoterTRE2Available SinceAug. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-AREG-ScNeo
Plasmid#209897PurposeTo monitor the status of Amphiregulin, the plasmid encodes a recombinant AREG fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF5-FRT-V5-DEST-GFP-Kif26b
Plasmid#102862PurposeExpresses GFP-Kif26b in mammalian cellsDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMAL-Abl-PRM 4R
Plasmid#112087PurposeBacterial expression plasmid containing His and MBP tags for 4 PRM motif repeats of Human Abl.DepositorInsertAbl-PRM-4R (ABL1 Human)
TagsHis-6 and MBPExpressionBacterialMutationconstruct contains only the PRM motif of Abl1PromoterLacAvailable SinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
CRY2high-mCherry-Raf1
Plasmid#104064PurposeExpresses fusion of CRY2high mutant (CRY2PHR E490R) with mCherry and Raf1DepositorExpressionMammalianMutationCRY2PHR E490RPromoterCMVAvailable SinceDec. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mGFAP(ABC1D)-2pabPAC(F198Y)
Plasmid#234548Purposeto express a version with reduced constitutive activity (thanks to point mutation F198Y) of the optogenetic tool 2pabPAC, which increases cAMP levels when stimulated by blue light, in astrocytesDepositorInsert2pabPAC(F198Y)
UseAAVMutationF198YPromotermGFAP(ABC1D)Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNL-CEF-CD79B-YFP
Plasmid#187006PurposeExpression of human CD79B as YFP fusion proteinDepositorAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBbleo-EGF-ScNeo
Plasmid#209902PurposeTo monitor the status of EGF, the plasmid encodes a recombinant EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertEGF-ScNeo (EGF )
TagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…ExpressionMammalianAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
CSNK1A1_pLX307
Plasmid#98326PurposeLentiviral expression of CSNK1A1DepositorAvailable SinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGS_107
Plasmid#160650PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of the yeast Gal promoterDepositorInsertApolipoprotein E e4 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterGAL1Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA.3.1.ADRB2-NP
Plasmid#134376PurposeNanoluc complementation assay. Expression of adrenoceptor beta 2 fused at C termimus with Natural peptide (NP) of NanoLuc. Addition of signal sequence and Flag epitope at N terminus of ADRB2.DepositorInsertADRB2-NP (ADRB2 Human)
TagsFlag, natural peptide of nanoluciferase, and sign…ExpressionBacterial and MammalianPromoterT7Available SinceAug. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
CCNT1_pLX307
Plasmid#98328PurposeLentiviral expression of CCNT1DepositorInsertCCNT1 (CCNT1 Human)
UseLentiviralTagsV5ExpressionMammalianMutationH519R, S566P, and P712SPromoterE1FaAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only