We narrowed to 88,146 results for: Ina
-
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSUMO His6 SUMO SnRK2.3 (19-361)
Plasmid#177846PurposeBacterial Expression of SnRK2.3DepositorAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral N
Plasmid#113009PurposeFor bacterial expression of MBP fusion of N terminal region of Drosophila TralDepositorAvailable SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral C
Plasmid#113008PurposeFor bacterial expression of MBP fusion of C terminal region of Drosophila TralDepositorAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral C 15A
Plasmid#113007PurposeFor bacterial expression of MBP fusion of C terminal region of Drosophila Tral phosphomutant (15A)DepositorInsertC terminus of tral (tral Fly)
ExpressionBacterialMutationPNG phosphorylation sites mutated to AAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEf1a-superDn29-dCas9-P2A-GFP
Plasmid#247156PurposeMammalian expression of a human codon optimized engineered superDn29 recombinase fused to dCas9 and gRNA expression cassette for targeting attH1 with H1-g3DepositorInsertsuperDn29-dCas9-P2A-GFP
TagsSV40 NLSExpressionMammalianMutationM6I/E70G/A224P/G227V/I233K/K248R/I303K/Q332K/N341…PromoterEf1aAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-N-Flag-NLRP3
Plasmid#75127PurposeExpresses N-terminal Flag-tagged NLRP3 in mammalian cellsDepositorInsertNLR family, pyrin domain containing 3 (Nlrp3 Mouse)
TagsFlagExpressionMammalianPromoterCMVAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.N
Plasmid#127851Purposenon-standard AAV2 rep-AAV-PHP.N cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.N VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-N-Flag-Caspase-1
Plasmid#75128PurposeExpresses N-terminal Flag-tagged Caspase-1 in mammalian cellsDepositorInsertcaspase 1 (Casp1 Mouse)
TagsFlagExpressionMammalianMutationP341S in Caspase-1 (please see depositor comments…PromoterCMVAvailable SinceMay 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
DiLiCre 2.0
Plasmid#198752PurposeA Cre recombinase that is expressed upon doxycycline when combined with the UbC-blasticidine-P2A-TETon-3G transactivator. DiLiCre 2.0 is a cre recombinase that is activated by violet light.DepositorInsertCre-PhoCI-ERT2-ERT2
UseLentiviralTagsCre, kept in a photocleavable site, followed by 2…ExpressionBacterial and MammalianPromoterTRE3GVAvailable SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.V1
Plasmid#127847Purposenon-standard AAV2 rep-AAV-PHP.V1 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.V1 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/myc-His-A-YAP2-1st&2nd WW mut
Plasmid#19061DepositorInsertYes-kinase associated protein (YAP1 Human)
ExpressionMammalianMutationTryptophan 199 changed to Alanine,and Proline 202…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-3xNLS-mScarlet
Plasmid#191098PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-mScarlet
UseAAV and Synthetic BiologyTagsThree repeats of the nuclear localizzation seque…ExpressionMammalianMutationOptimized to human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-Mb-sfGFP WT
Plasmid#197569PurposeExpression of sfGFP WT with Methanosarcina barkeri (Mb) Pyl-tRNA for the encoding of non-canonical amino acids at TAG codons in HEK293 cellsDepositorInsertssfGFP WT
Pyl-tRNA (4 copies)
TagsV5-His6ExpressionMammalianPromoterCMV and U6/H1Available SinceApril 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-iFlpV
Plasmid#140137Purposecan be used to generate AAV virus that will express light-inducible site-specific iFlpV recombinaseDepositorHas ServiceAAV PHP.eB and AAV1InsertiFlpV
UseAAVPromoterEF1aAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-3xNLS-vsfGFP-0
Plasmid#191097PurposeTo express a bright green nanobody FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-vsfGFP-0
UseAAVTagsGreen fluorescent protein bound to enhancer nanob…ExpressionMammalianMutationOptimized to Human codon usagePromoterCMV and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pARC8-LambdaRedBeta-EcSSB-EcMutLE32K
Plasmid#162576PurposeArabinose inducible recombineering plasmid encoding Lambda-Red Beta with EcSSB for use with dsDNA templates and enhanced recombination efficiency. Contains a dominant negative mismatch repair protein.DepositorInsertsLambda Red-Beta
E. coli SSB
EcMutLE32K
ExpressionBacterialMutationE32K mutated to give dominant negative phenotypePromoterpBADAvailable SinceMay 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
p2xFlag CMV2-YAP2-1st&2nd WW mutant
Plasmid#19048DepositorInsertYes-kinase associated protein (YAP1 Human)
Tags2xFlagExpressionMammalianMutationTryptophan 199 changed to Alanine,and Proline 202…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-3xNLS-AausFP1
Plasmid#191096PurposeTo express a bright green FP to label eucaryotic cell nuclei. To be used in tissue-clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-AausFP1
UseAAV and Synthetic BiologyTagsThree repeats of the nuclear localizzation seque…ExpressionMammalianMutationOptimized to Human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only