We narrowed to 6,423 results for: org
-
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBI101.1/ProGOXL6:GUS
Plasmid#175562PurposeBinary vector for Agrobacterium-mediated plant transformation - Promoter:GUS reporter for expression analysis of GOXL genesDepositorInsertProGOXL6
TagsGUSExpressionPlantPromoterGOXL6Available SinceJan. 13, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBI101.1/ProGOXL5:GUS
Plasmid#175561PurposeBinary vector for Agrobacterium-mediated plant transformation - Promoter:GUS reporter for expression analysis of GOXL genesDepositorInsertProGOXL5
TagsGUSExpressionPlantPromoterGOXL5Available SinceJan. 13, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBI101.1/ProGOXL4:GUS
Plasmid#175560PurposeBinary vector for Agrobacterium-mediated plant transformation - Promoter:GUS reporter for expression analysis of GOXL genesDepositorInsertProGOXL4
TagsGUSExpressionPlantPromoterGOXL4Available SinceJan. 13, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBI101.1/ProGOXL3:GUS
Plasmid#175559PurposeBinary vector for Agrobacterium-mediated plant transformation - Promoter:GUS reporter for expression analysis of GOXL genesDepositorInsertProGOXL3
TagsGUSExpressionPlantPromoterGOXL3Available SinceJan. 13, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBI101.1/ProGOXL2:GUS
Plasmid#175558PurposeBinary vector for Agrobacterium-mediated plant transformation - Promoter:GUS reporter for expression analysis of GOXL genesDepositorInsertProGOXL2
TagsGUSExpressionPlantPromoterGOXL2Available SinceJan. 13, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
LentiCRISPRv2-neo-dTgfa
Plasmid#173842PurposeA knockout vector for the dog Tgfa.DepositorInsertA gRNA targeting the dog Tgfa gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-Ptgfr
Plasmid#170303PurposeA knock-out vector for the mouse PtgfrDepositorInsertA gRNA targeting the mouse Ptgfr gene.
UseCRISPR and LentiviralAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_CV2
Plasmid#167165PurposepgRNA_CV2 is derived from gRNA_cloning vector (Addgene plasmid ID: 41824) by adding about 80 bps from the sgRNA sequence as well as an AgeI site. In the literature, sgRNA_AL is used as an alias.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pSR11
Plasmid#69154Purposeread-outloxP mCherry to GFP switch, with fzr-1 promoter, gene and UTR, for integration on cxtTi10816, Mos Chr IVDepositorInsertsUseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterfzr-1 and rps-27Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSMP-MBD4_3
Plasmid#36376DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSMP-MBD4_2
Plasmid#36375DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
SpeckSeq library
Pooled Library#248187PurposeThe SpeckSeq library is a pooled lentiviral plasmid library containing 229 distinct variants of the MEFV gene, each linked to a unique barcode.DepositorExpressionMammalianSpeciesHomo sapiensUseLentiviralAvailable SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
-
JD633
Plasmid#160393PurposeCRISPR-Cas9 vector including GRF4-GIF1. For wheat and other monocots CRISPR experiments. Includes two AarI sites for gRNA cloningDepositorInsertsZmUbi::wheat GRF4-GIF1 chimera
ZmUbi:TaCas9 + TaU6:gRNA
UseBinary vectorAvailable SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSIN-PAmCherry-KFERQ-NE
Plasmid#102365PurposeLentiviral overexpression of PA-mCherry-KFERQ fusionDepositorInsertsPA-mCherry
KFERQ peptide
UseLentiviralTagsNEExpressionMammalianPromoterEF-1aAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Tau(WT)
Plasmid#187023PurposeExpresses EGFP tagged human 2N4R tau (WT) in mammalian cells with CMV promoterDepositorAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP Abi1
Plasmid#74905PurposeExpresses human Abi1 fused to GFPDepositorAvailable SinceMay 3, 2016AvailabilityAcademic Institutions and Nonprofits only