We narrowed to 1,099 results for: gfp fluorescence reporter
-
Plasmid#191119PurposeA plasmid for incorporation of O-Me-Tyr into an EGFP reporter without O-Me-Tyr feeding for zebrafishDepositorInsertMfnG - P2A - Mutant E. coli TyrRS - T2A - enhanced green fluorescence protein
TagsHis tagExpressionMammalianAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
hEF1α-H2B-mOrange2-IRES-EGFP PGK-Puromycin
Plasmid#99277PurposeDual fluorescent reporter - constitutive expression of mOrange2 (549/565) localized in the nucleus, EGFP (488/507) untargeted and visualized in the cytoplasm, and Puromycin resistanceDepositorInsertsH2B-mOrange2-IRES-EGFP
Puro
UseLentiviralTagsEGFP, H2B, IRES, PGK, and mOrange2PromoterEF1 alpha-human and PGK-mouseAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
VV017: Archaerhodopsin-3 w/ D95Q point mutation fused to eGFP
Plasmid#58490PurposeExpresses Arch(D95Q)-eGFP in mammalian cells as a fluorescent reporter of membrane voltageDepositorInsertArchaerhodopsin-3 w/ D95H point mutation fused to eGFP
UseLentiviralTagseGFPExpressionMammalianMutationChanged Aspartic Acid 95 to GlutaminePromoterUbiquitinAvailable SinceAug. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDest-1.7kbfabp6-eGFP-pA-CrymCherry
Plasmid#159088PurposeLR construct using backbone with Cry:mCherry insert to identify fish with transgene, and with p5E-1.7kbfabp6, pME-eGFP, and p3E-pA insertsDepositorInsertsUseFluorescent reporterPromoter1.7kb fabp6Available SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCherryGFP-CoV2-Inframe-stop
Plasmid#177620PurposeDual fluorescent protein reporter for SARS-CoV-2 programmed -1 ribosomal frameshifting. GFP is in-frame with mCherry. Thus GFP translation is prevented by stop codon within FSE (negative control).DepositorInsertSARS-CoV-2 FSE
UseLentiviralExpressionMammalianAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.ARID3a.IRES.GFP
Plasmid#169300PurposeConstitutive overexpression of human ARID3A cDNA with GFP as reporter fluorescent proteinDepositorAvailable SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.mArid3a.IRES.GFP
Plasmid#169309PurposeConstitutive overexpression of murine Arid3a cDNA with GFP as reporter fluorescent proteinDepositorAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDD0257 pCS2-sfCherry11Mx4-10aa-zH2B-SV40NLS-sfGFP-NPLnls
Plasmid#251772PurposeNuclear reporter for fluorescent protein reconstitution assayDepositorInsertH2B (hist2h2l Zebrafish)
Tags4x sfCherry3C small fragments, NLS (SV40) and NLS…ExpressionMammalianPromoterCMV IE94Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.KRAB-mArid3a.IRES.GFP
Plasmid#169306PurposeConstitutive overexpression of murine KRAB-Arid3a fusion protein with GFP as reporter fluorescent proteinDepositorAvailable SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.VP64-mArid3a.IRES.GFP
Plasmid#169313PurposeConstitutive overexpression of murine VP64-Arid3a fusion protein with GFP as reporter fluorescent proteinDepositorAvailable SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV mCherry-GFP-LC3B WT
Plasmid#123230PurposeExpresses mCherry-EGFP-LC3B wild-type in mammalian cells. Fluorescent tandem reporter for autophagosomes. High expression driven by CMV promoter.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFP and mCherryExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 T21R-vhhGFP4-T2A-mCherry
Plasmid#225587PurposeMammalian expression vector for TRIM21 RING-vhhGFP4 anti-GFP degrader with a self-cleaving T2A-mCherry fluorescent expression reporterDepositorInsertT21R-vhhGFP4-T2A-mCherry
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLX304 Flag-mCherry-eEF1A1_IRES-GFP
Plasmid#198383PurposeeEF1A1 fluorescent reporterDepositorAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-0.27kb-EGFP
Plasmid#153185PurposeTruncated mouse gamma-synuclein (mSncg-0.27kb) promoter-mediates gene expression in retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPB-Neo-COVGT5-d2EGFP-mCherry
Plasmid#201454PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT5_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-0.66kb-EGFP
Plasmid#153165PurposeTruncated mouse gamma-synuclein (mSncg-0.66kb) promoter-mediates gene expression in retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-1.03kb-EGFP
Plasmid#153164PurposeTruncated mouse gamma-synuclein (mSncg-1.03kb) promoter-mediates gene expression in mammalian retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
SCN1Aprom(335-406)-H2B-GFP
Plasmid#236151PurposeFluorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with the SCN1a promoter region encompassing 335 to 406 bp upstream of its transcriptional start siteDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with the SCN1a promoter regi…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-Neo-COVGT1-d2EGFP-mCherry
Plasmid#201451PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT1_d2EGFP-mCherry
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only