We narrowed to 6,411 results for: kit
-
Plasmid#154335PurposeCrispr repair template: add insertion site specific homology arms by PCR before insertionDepositorInsert30aa linker::GFP::AID*::3xFLAG::10aa linker
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSH-EFIRES-P-GFP(1-10)opti
Plasmid#129416PurposeExpressing codon-optimized GFP(1-10) fragment in human cellsDepositorInsertcodon-optimized GFP(1-10)
UseCRISPR, TALEN, and Unspecified ; Human safe harbo…TagsExpressionMammalianMutationPromoterEF-1αAvailable sinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-short_BrokenHeart (no BC)
Plasmid#86950PurposeAAV transfer plasmid containing the BrokenHeart construct: a hyperpiggybac donor transposon interrupting the tdTomato fluorophore. Transposase activity rescues coding sequence.DepositorInsertBrokenheart construct
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW2172
Plasmid#163096PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsert30aa linker::mNeonGreen (dpi)::3xFLAG::10aa linker
UseCRISPRTagsExpressionWormMutationSilent mutations to remove piRNA sitesPromoterAvailable sinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMXs-ms-Klf5
Plasmid#50787Purposeretroviral expression of mouse Klf5DepositorInsertKlf5 (Klf5 Mouse)
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTD79
Plasmid#172900PurposeNeuronal promoter rgef-1P::TIR1::F2A::TagBFP2::AID* with homology arms for insertion in ttTi4348 site on chromosome IDepositorInsertTIR-1 (TIR1 Mustard Weed)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
JWW-2 human chimeric monoclonal antibody
Plasmid#66749PurposeExpresses a murine/human chimeric IgG1 HPV16 L2-specific neutralizing antibody that recognizes HPV16 L2 amino acid region 58-64 . JWW-2 works in ELISA/WB/HPVDepositorInsertsJWW-2 Heavy Chain
JWW-2 Light Chain
UseTagsExpressionMammalianMutationPromotermEF1 and rEF1Available sinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4
Plasmid#170855PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of any transgene in neurons under the control of the hSyn1 promoter.DepositorTypeEmpty backboneUseAAVTagsExpressionMammalianMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
AAV-hSyn-REX-GECO1
Plasmid#61248PurposeExpresses REX-GECO1 in neuronsDepositorInsertREX-GECO1
UseAAVTagsExpressionMammalianMutationSubstitutions relative to R-GECO1: P60R, V61W, R6…PromoterhSynAvailable sinceMarch 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET24a-VHH-2xTS
Plasmid#109419PurposeBacterial expression of a functionalized anti-GFP (VHH) nanobody fused to two tyrosine sulfation (TS) motifs. VHH-2xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-GFP nanobody fused to a T7, TS, HA, BAP and His6 epitope
UseTagsBAP, HA, His6, T7, and Tyrosine sulfation (TS) se…ExpressionBacterialMutationPromoterT7Available sinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FLEX(frt)-GCaMP6f-WPRE
Plasmid#118273PurposepAAV vector for flippase dependent GCaMP6f expression under the control of EF1a promoterDepositorInsertGCaMP6f
UseAAVTags6xHis (N terminal on insert), T7 epitope, and Xpr…ExpressionMammalianMutationPromoterEF1aAvailable sinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJH127
Plasmid#162483PurposeSEC plasmid containing LG1 homology arms and myo-2p::TIR1::F2A::BFP::AID*::NLS::tbb-2 3'UTR, for expression of TIR1 and nuclear BFP reporter in C. elegans.DepositorInsertmyo-2p::TIR1::F2A::AID*::NLS::tbb-2 3'UTR
UseCRISPRTagsmyo-2p::TIR1::F2A::AID*::NLS::tbb-2 3'UTRExpressionWormMutationPromoterAvailable sinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5
Plasmid#170856PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of any transgene in neurons under the control of the hSyn1 promoter.DepositorTypeEmpty backboneUseAAVTagsExpressionMammalianMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
MAC-CLEC4E
Plasmid#172412PurposeMAC-tagged gene expressionDepositorInsertC-type lectin domain family 4 member E (CLEC4E Human)
UseTagsMAC-tagExpressionMammalianMutationPromoterCMV promoterAvailable sinceNov. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJW2072
Plasmid#154334PurposeCrispr repair template: add insertion site specific homology arms by PCR before insertionDepositorInsert30aa linker::mScarlet-I (dpi)::3xMyc::10aa linker
UseCRISPRTagsExpressionWormMutationSilent mutations to remove piRNA sitesPromoterAvailable sinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-GCaMP6f
Plasmid#178728PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of GCaMP6f in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGCaMP6f
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS6
Plasmid#170857PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of any transgene in neurons under the control of the hSyn1 promoter.DepositorTypeEmpty backboneUseAAVTagsExpressionMammalianMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only