We narrowed to 60,265 results for: des.1
-
Plasmid#206715PurposeMammalian Expression Plasmid of anti-GluN2B/NR2B glutamate receptor (Rat). Derived from hybridoma N59/36-1.DepositorInsertanti-GluN2B/NR2B glutamate receptor (Rattus norvegicus) recombinant Mouse monoclonal antibody (Grin2b Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-GluN2A/NR2A glutamate receptor [N327/95R-1]
Plasmid#206710PurposeMammalian Expression Plasmid of anti-GluN2A/NR2A glutamate receptor (Rat). Derived from hybridoma N327/95-1.DepositorInsertanti-GluN2A/NR2A glutamate receptor (Rattus norvegicus) recombinant Mouse monoclonal antibody (Grin2a Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-Kv4.2 K+ channel (external) [K57/1R-1]
Plasmid#206682PurposeMammalian Expression Plasmid of anti-Kv4.2 K+ channel (external) (Human). Derived from hybridoma K57/1-1.DepositorInsertanti-Kv4.2 K+ channel (external) (Homo sapiens) recombinant Mouse monoclonal antibody (KCND2 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-GluN2B/NR2B glutamate receptor [N59/20R-1]
Plasmid#206714PurposeMammalian Expression Plasmid of anti-GluN2B/NR2B glutamate receptor (Rat). Derived from hybridoma N59/20-1.DepositorInsertanti-GluN2B/NR2B glutamate receptor (Rattus norvegicus) recombinant Mouse monoclonal antibody (Grin2b Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GST-ATG9 (828-839)-ATG101 (1-198)
Plasmid#188073PurposeTo make ATG101/ATG13-HORMA and ATG9 C-terminal tail fusion complex for expression in mammalian cellsDepositorTagsGST tagExpressionMammalianMutationcodon-optimized ATG9 (828-839) and codon-optimize…PromoterCMVAvailable SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMIG-hNFATc2/C(1-686, RIT)FLAG-AVITEV
Plasmid#74055Purposeretroviral expression plasmid for human NFATc2/C(1-686, RIT) (without C-terminal region, with RIT mutation abrogating AP1 binding) with C-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc2, isoform C (NFATC2 AS 1-686 (N terminus deleted), Human)
UseRetroviralTagsAVI-TEV and FLAGExpressionMammalianMutationsilent mutation A1723C in the sequence of NM_1730…Available SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
Anti-GluA2/GluR2 glutamate receptor [L21/32R-1]
Plasmid#206693PurposeMammalian Expression Plasmid of anti-GluA2/GluR2 glutamate receptor (Rat). Derived from hybridoma L21/32-1.DepositorInsertanti-GluA2/GluR2 glutamate receptor (Rattus norvegicus) recombinant Mouse monoclonal antibody (Gria2 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-Ataxin-1 [N76/8R-rat IgG2a] - Chimeric
Plasmid#231837PurposeMammalian expression plasmid of anti-Ataxin-1 (Mouse) rat IgG2a R-mab. Derived from hybridoma N76/8.DepositorInsertAnti-Ataxin-1 (Mus musculus) recombinant mouse monoclonal antibody (Atxn1 Chimera: M. musculus (mouse)/R. norvegicus (rat))
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterDual CMVAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
Anti-AMIGO-1 [L86/33-rat IgG2a] - Chimeric
Plasmid#227038PurposeMammalian expression plasmid of anti-AMIGO-1 (Mus musculus) rat IgG2a R-mAb. Derived from hybridoma L86/33.DepositorInsertAnti-AMIGO-1 (Mus musculus) recombinant mouse monoclonal antibody. (Amigo1 Chimera: M. musculus (mouse)/R. norvegicus (rat))
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterDual CMVAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
Anti-AMIGO-1 [L86/36-rat IgG2a] - Chimeric
Plasmid#227039PurposeMammalian expression plasmid of anti-AMIGO-1 (Mus musculus) rat IgG2a R-mAb. Derived from hybridoma L86/36.DepositorInsertAnti-AMIGO-1 (Mus musculus) recombinant mouse monoclonal antibody. (Amigo1 Chimera: M. musculus (mouse)/R. norvegicus (rat))
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterDual CMVAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
Antibody#180111-rAbPurposeAnti-Navbeta4 Na+ channel (Rat) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunocytochemistry and ImmunohistochemistryReactivityMouse and RatSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceMarch 30, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits
-
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA (AAV8)
Viral Prep#61592-AAV8PurposeReady-to-use AAV8 particles produced from pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA (#61592). In addition to the viral particles, you will also receive purified pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA plasmid DNA. CMV-driven expression of SaCas9. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.cTNT.iCre (AAV9)
Viral Prep#69916-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.cTNT.iCre (#69916). In addition to the viral particles, you will also receive purified pAAV.cTNT.iCre plasmid DNA. cTnT driven in vivo expression of Cre and tdTomato (separated by IRES sequence). These AAV preparations are suitable purity for injection into animals.DepositorPromoterChicken cardiac troponin TTagstdTomatoAvailable SinceJuly 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA (AAV6)
Viral Prep#61592-AAV6PurposeReady-to-use AAV6 particles produced from pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA (#61592). In addition to the viral particles, you will also receive purified pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA plasmid DNA. CMV-driven expression of SaCas9. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-hChR2-H134R-tdTomato (AAV Retrograde)
Viral Prep#28017-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-CAG-hChR2-H134R-tdTomato (#28017). In addition to the viral particles, you will also receive purified AAV-CAG-hChR2-H134R-tdTomato plasmid DNA. Humanized channelrhodopsin H134R mutant fused to tdTomato, under the control of the CAG promoter. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomatoAvailable SinceJune 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO eNpHR 3.0-EYFP (AAV Retrograde)
Viral Prep#26966-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-Ef1a-DIO eNpHR 3.0-EYFP (#26966). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO eNpHR 3.0-EYFP plasmid DNA. EF1a-driven, cre-dependent eNpHR 3.0-EYFP for optogenetic inhibition. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
Antibody#241893-rAbPurposeAnti-Netrin 1 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; recognizes human and mouse Netrin 1. Does not cross-react with other netrins.DepositorArticleRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceDec. 17, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#241894-rAbPurposeAnti-Netrin 1 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; recognizes human and mouse Netrin 1. Does not cross-react with other netrins.DepositorArticleRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceDec. 17, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#241895-rAbPurposeAnti-Netrin 1 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; recognizes human and mouse Netrin 1. Does not cross-react with other netrins.DepositorArticleRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceDec. 17, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits