We narrowed to 4,533 results for: Gaa
-
Plasmid#254426PurposeMammalian expression plasmid encoding an shRNA targeting tRNA-Phe(GAA).DepositorInserttRNA-Phe (anticodon GAA) 1-4
UseLentiviralPromoterU6Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shtRNA-Phe(GAA)-2
Plasmid#254427PurposeMammalian expression plasmid encoding an shRNA targeting tRNA-Phe(GAA).DepositorInserttRNA-Phe (anticodon GAA) 1-4
UseLentiviralPromoterU6Available SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A-inactive+sgAAVS1_145
Plasmid#213170PurposeVector with sgAAVS1 used as a negative control (inactive DNMT3A) for induction of global DNA methylation.DepositorInsertsgAAVS1_145
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A-inactive+sgAAVS1_118
Plasmid#213171PurposeVector with sgAAVS1 used as a negative control (inactive DNMT3A) for induction of global DNA methylation.DepositorInsertsgAAVS1_118 (AAVS1 Human)
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2-F1-GTG-F2-GGT-F3-GAA
Plasmid#30707DepositorInsertF1 GTG, F2 GGT, F3 GAA
UseMrna productionTagsHAAvailable SinceNov. 9, 2011AvailabilityAcademic Institutions and Nonprofits only -
23SrRNA.RAV12(wt).2508-2580.GAAAC.duplexH90
Plasmid#26192DepositorInsert23S ribosomal RNA fragment (modified) with duplex H90
ExpressionBacterialMutationfragment 2508-2580 of E. coli rRNA, with nucleoti…Available SinceDec. 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
23SrRNA.RAV12(wt).2508-2580.GAAAC.G2553U
Plasmid#26191DepositorInsert23S ribosomal RNA fragment (modified) with G2553U mutation
ExpressionBacterialMutationfragment 2508-2580 of E. coli rRNA, with nucleoti…Available SinceOct. 28, 2010AvailabilityAcademic Institutions and Nonprofits only -
pKSB-618 U6-sgRNA2/3 GGAA AACA
Plasmid#173674PurposeTo clone and express a gRNA in AnophelesDepositorTypeEmpty backboneUseCRISPRExpressionInsectAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKSB-609 U6-sgRNA1 ATCC GGAA
Plasmid#173671PurposeTo clone and express a gRNA in AnophelesDepositorTypeEmpty backboneUseCRISPRExpressionInsectAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKSB-610 U6-sgRNA2 GGAA AGAG
Plasmid#173672PurposeTo clone and express a gRNA in AnophelesDepositorTypeEmpty backboneUseCRISPRExpressionInsectAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-deltaU6-tRNA-Phe(GAA) 1-4
Plasmid#254428PurposeMammalian expression plasmid encoding human tRNA-Phe(GAA) isodecoder 1-4.DepositorInserttRNA-Phe (anticodon GAA) 1-4
UseLentiviralAvailable SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b ITGA2-tail-YPet (GFFKR/GAAKR)
Plasmid#145144PurposeShuttle vector with YPet-tagged ITGA2 cytoplasmic tail as an insert with a GFFKR/GAAKR mutationDepositorInsertITGA2-tail-YPet (GFFKR/GAAKR) (ITGA2 Human)
UseGateway CloningAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3- sgAAVS1.5-CAG-Cas9-T2A-mCherry-P2A-Puro
Plasmid#216246PurposeExpress Cas9 with CAG promoter to improve the expression in hES cells and a highly efficient sgAAVS1.5 for AAVS1 integrationDepositorInsertCas9 and sgAAVS1.5
UseCRISPR; Human safe harbor locus (a avs1) site-spe…ExpressionMammalianPromoterCAGAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA (AAV8)
Viral Prep#154867-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA (#154867). In addition to the viral particles, you will also receive purified pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA plasmid DNA. Syn-driven, Flp-dependent hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterHuman Synapsin-1TagsmCherry (Flp-dependent)Available SinceAug. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA (AAV Retrograde)
Viral Prep#154867-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA (#154867). In addition to the viral particles, you will also receive purified pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA plasmid DNA. Syn-driven, Flp-dependent hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal inhibition. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterHuman Synapsin-1TagsmCherry (Flp-dependent)Available SinceOct. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
Wolfe-Lawson ZFN modular assembly kit
Plasmid Kit#1000000018PurposeEngineering zinc finger arrays by modular assembly.DepositorApplicationGenome EditingVector TypeZebrafish ExpressionEditing TypeZFNAvailable SinceNov. 9, 2011AvailabilityAcademic Institutions and Nonprofits only -
GL2 shRNA
Plasmid#86083PurposeA lentiviral construct for building stable cell lines expressing GL2 shRNA via puromycin selection.DepositorInsertcontrol shRNA
PromoterU6Available SinceMay 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
Sf-U7snRNA-ESE-AS-NsiI
Plasmid#190694PurposeBasic vector used for the expression of U7-based antisense oligonucleotidesDepositorInsertU7 snRNA
UseLentiviralExpressionMammalianPromoterU7 promoterAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-THAP11-rescue
Plasmid#37001DepositorInsertTHAP11 (THAP11 Human)
Tags3xFLAGExpressionMammalianMutationMutations were generated at codons 273-275 conver…Available SinceMay 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
SF-U7snRNA-CypA-E4
Plasmid#190695PurposeControl vector expressing a U7-based antisense oligonucleotide targeting CypA exon 4DepositorInsertU7 snRNA antisense CypA Exon 4
UseLentiviralExpressionMammalianPromoterU7 promoterAvailable SinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBABE-EGFP-THAP11-rescue-3xFLAG
Plasmid#37000DepositorInsertTHAP11 (THAP11 Human)
UseRetroviralTags3xFLAGExpressionMammalianMutationMutations were generated at codons 273-275 conver…Available SinceMay 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBABE-puro-THAP11-rescue-3xFLAG
Plasmid#36998DepositorInsertTHAP11 (THAP11 Human)
UseRetroviralTags3xFLAGExpressionMammalianMutationMutations were generated at codons 273-275 conver…Available SinceMay 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLA230
Plasmid#11724DepositorInsertb-lactamase
ExpressionBacterialMutationGAA for Glu26 changed to TAA (premature stop codo…Available SinceAug. 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
-
Musunuru-Cowan TALEN Kit
Plasmid Kit#1000000034PurposeThis collection allows the efficient assembly of TALEN constructs with custom repeat arrays, each containing 15 repeats for expression in mammalian cells.DepositorApplicationGenome EditingVector TypeMammalian ExpressionEditing TypeTALENAvailable SinceJuly 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrCdh2.1 GFP
Plasmid#209100PurposeGFP expressing scramble of shRNA targeting Cdh2DepositorInsertscrCdh2.1
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCdh10.1 GFP
Plasmid#209101PurposeGFP expressing shRNA targeting Cdh10DepositorInsertshCdh10.1
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
MYMH 333
Plasmid#138056PurposeEncodes Ribosome Binding Site (RBS) variant using GFP as a reporter geneDepositorInsertpSEVA-331Bb-1AG 11AC-GFP
ExpressionBacterialMutationGAA GAG GAG ACAAvailable SinceApril 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
MYMH 57
Plasmid#138043PurposeEncodes Ribosome Binding Site (RBS) variant using GFP as a reporter geneDepositorInsertpSEVA-331Bb-10AG-GFP
ExpressionBacterialMutationAAA GAG GAG GAAAvailable SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only