We narrowed to 82,966 results for: myc
-
Plasmid#101167PurposeE. coli/S. cerevisiae shuttle vector carrying amdS andSpcas9D147Y P411T and expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 and in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_hph
Plasmid#184919PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_hph recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-α-COPI-WD40
Plasmid#180758PurposeMammalian expression plasmid for Schizosaccharomyces pombe α-COPI-WD40 (residues 1-327)DepositorInsertα-COPI-WD40
TagsC-terminal strep tagExpressionMammalianMutationEncodes residues 1-327; mutations: Leu181Lys, Leu…PromoterCMVAvailable SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMALp2x-SCO5461(E164D)(43-204)
Plasmid#42508DepositorInsertguanosine ADP-ribosyltransferase (SCO5461 Streptomyces coelicolor A3(2))
Tagsmaltose-binding proteinExpressionBacterialMutationDeleted amino acids 1-42 (nucleotide 1-126); chan…PromotertacAvailable SinceApril 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pUDR211
Plasmid#113870Purposeexpression of Cas9 programming sgRNA3 and sgRNA4 targetting HXT8 and HXT1 respectivelyDepositorInsertsgRNA3-HXT8 / sgRNA4-HXT14
ExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDR418
Plasmid#113875Purposeexpression of double Cas9 programming sgRNA11 targetting STL1DepositorInsertdoble sgRNA11-STL1
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKG01701_CMV-rtTA-betaglobin_pA-CMV-PuroR-bGH
Plasmid#252540PurposeSecondary PiggyBac vector for puromycin selection and expression of transcriptional activatorDepositorInsertrtTA
ExpressionMammalianPromoterCMV (human cytomegalovirus immediate early enhanc…Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCfB8709
Plasmid#175224PurposeXenopus oocyte expression vector containing YOL092W. Contains T7 RNA polymerase binding site, and adds polyA tail to YOL092W. Used for generation of mRNA, for injection into xenopus laevis oocytes.DepositorInsertYOL092W (CEN.PK strain)
UseMrna expression, injection into xenopus oocytesTagsPolyAPromoterT7Available SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET21a Mp-iPGM
Plasmid#180243PurposeBacterial expression plasmid for production of recombinant Mycoplasma pneumoniae iPGM His10DepositorInsertMycoplasma pneumoniae iPGM-10His
TagsHisExpressionBacterialPromoterT7Available SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
EC2_2_dCas9_VP64_sgRNA
Plasmid#163707PurposeYeast low copy plasmid with dCas9, sgRNA expression cassette and VP64 activation domainDepositorInsertsdCas9
VP64+SV40 NLS
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPodA11
Plasmid#162843PurposeExpression protein designed PodA10 from a TEV cleavable IPTG inducible plasmid with ampicillin resistanceDepositorInsertProtein Designed Pyocyanin demethylase
TagsTEV-cleavable 6x-His tagExpressionBacterialMutationA53N, I73T, A87V, M99V, A129T from WT PodAPromoterT7Available SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKP110 [pRS416-YBR139Wp-YBR139W(N163,242Q)-PA-ADH1t]
Plasmid#106462PurposeExpresses Atg42/Ybr139w(N163,242Q) with a C-terminal PA tag in yeast cellsDepositorInsertYBR139W(N163,242Q)
TagsPAExpressionBacterial and YeastMutationchanged Asparagines at positions 163 and 242 to G…PromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP129 [pRS406-YBR139Wp-YBR139W(S219A)-GFP-ADH1t]
Plasmid#106466PurposeExpresses Atg42/Ybr139w(S219A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(S219A)
TagsGFPExpressionBacterial and YeastMutationChanged Serine 219 to AlaninePromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP131 [pRS406-YBR139Wp-YBR139W(H474A)-GFP-ADH1t]
Plasmid#106467PurposeExpresses Atg42/Ybr139w(H474A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(H474A)
TagsGFPExpressionBacterial and YeastMutationChanged Histidine 474 to AlaninePromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP133 [pRS406-YBR139Wp-YBR139W(D415A)-GFP-ADH1t]
Plasmid#106468PurposeExpresses Atg42/Ybr139w(D415A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(D415A)
TagsGFPExpressionBacterial and YeastMutationChanged Aspartate 415 to AlaninePromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLSB-HYG
Plasmid#166699PurposeCombined sgRNA/Cas9 pLSB vector with hphMX6 (hygromycin) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
ExpressionYeastPromoteradh15 promoter and tRNA promoterAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hATG7wt
Plasmid#87867PurposeExpress a wild type human Atg7/Apg7 in mammalian cellsDepositorAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-α-COPI-WD40-Asp115Ala
Plasmid#180760PurposeMammalian expression plasmid for Schizosaccharomyces pombe α-COPI-WD40 mutant Asp115Ala (residues 1-327)DepositorInsertα-COPI-WD40-Asp115Ala
TagsC-terminal strep tagExpressionMammalianMutationEncodes residues 1-327; mutations: Asp115Ala, Leu…PromoterCMVAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only