We narrowed to 7,057 results for: crispr cas9 plasmids
-
Plasmid#166080PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RRT8 for double stranded break formation in yeast.DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pNSU299_CPR1_2
Plasmid#166071PurposePlasmid for constituive spCas9 expression and tet-inducible expression of an sgRNA targeting an intergenic site near CPR1 for double stranded break formation in yeast.DepositorInsertIntergenic region near CPR1
UseCRISPRExpressionYeastPromoterTet-inducibleAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_LHS1
Plasmid#166092PurposePlasmid for constituive spCas9 and tet-inducible LHS1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_YNR071C
Plasmid#166081PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of YNR071C for double stranded break formation in yeast.DepositorInsertPromoter of YNR071C (YNR071C Budding Yeast)
UseCRISPRExpressionYeastPromoterTet-inducibleAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6-Nme2_tracr
Plasmid#192146PurposeExpresses Nme2-sgRNA cloned with BspQIDepositorInsertNme2 sgRNA scaffold
UseAAVExpressionMammalianAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRS423-TyrSgH
Plasmid#163973PurposeHelper plasmid for cloning gRNAs under the control of the tRNA(Tyr) promoterDepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS423-SgH
Plasmid#163972PurposeHelper plasmid for cloning gRNAs under the control of the SNR52 promoter.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS423-ProSgH
Plasmid#163974PurposeHelper plasmid for cloning gRNAs under the control of the tRNA(Pro) promoterDepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pV1200
Plasmid#111429PurposeCaCas9/gRNA Solo entry plasmid for cloning guides - contains stuffer with BsmBI sites - integrates at ENO1 - Recyclable for serial mutagenesis (Sap2-FLP)DepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX459-gR2A_Hinge
Plasmid#124811PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a>Fab-srt-his plasmids to convert expression of hybridomas to Fab' fragments.DepositorInsertCas9 – gRNA_R2A_hinge
UseCRISPRTags3XFLAG and GFPExpressionBacterial and MammalianMutationR166H in PuroR (please see depositors comment bel…PromoterpUCAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28b-BE3∆UGI
Plasmid#96943PurposeThe plasmid encoding the His6-rAPOBEC1-XTEN-nCas9 protein (BE3∆UGI) was generated by site-directed mutagenesis using pET28b-BE1 (Addgene plasmid #73018).DepositorInsertBE3∆UGI
TagsHis6 tagExpressionBacterialPromoterT7Available SinceSept. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_CUP1-1
Plasmid#166086PurposePlasmid for constituive spCas9 and tet-inducible CUP1-1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RPL22A
Plasmid#166079PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RPL22A for double stranded break formation in yeast.DepositorAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
p184_LTJ_sgRNACD90.2
Plasmid#82670PurposesgRNA targeting murine CD90.2. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting mouse CD90.2
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
p183_LTJ_sgRNACD90.2_A
Plasmid#82671PurposesgRNA targeting murine CD90.2. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting CD90.2
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
p240_LTJ_sgRNAFoxp3K276X
Plasmid#82675PurposesgRNA targeting murine Foxp3 mutant. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting Foxp3 K276X
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
p163_LTJ_sgRNACD90.1
Plasmid#82677PurposesgRNA targeting murine CD90.1. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting mouse CD90.1
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1180 U6-reci Gag-pol v2
Plasmid#201915PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-pol
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRhaB-8xHis-ABE8e-eVRQR (LLH551)
Plasmid#242658PurposepRhaB promoter expression plasmid for ABE8e-eVRQR with an N-terminal His8-tagDepositorInsertpRhaB-8xHis-BPNLS-TadA8e-SpCas9(D10A)-eVRQR-BPNLS
UseCRISPRTags8x-HisExpressionBacterialMutationeVRQR mutations in SpCas9(S55R/D1135V/G1218R/R133…PromoterRhaBAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only