We narrowed to 24,895 results for: GRN
-
Plasmid#192677PurposeLentiviral expression of sgRNA targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNA #1 (IL1RN Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-RBMS3
Plasmid#185557PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting RBMS3DepositorInsertRBMS3 gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-DSP
Plasmid#185549PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting DSPDepositorInsertDSP gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-HHIP
Plasmid#185551PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting HHIPDepositorInsertHHIP gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-ADGRG6
Plasmid#185554PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting ADGRG6DepositorInsertADGRG6 gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Gly-tRNA-gRNA scaffold for library 2
Plasmid#192365PurposetRNA sequence provider (for checkpoint library)DepositorInsertGly tRNA-gRNA scaffold
UseFor golden gate assemblyAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Pro-tRNA-gRNA scaffold for library 2
Plasmid#192366PurposetRNA sequence provider (for checkpoint library)DepositorInsertPro tRNA-gRNA scaffold
UseFor golden gate assemblyAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Gln-tRNA-gRNA scaffold for library 1&2
Plasmid#192367PurposetRNA sequence provider (for checkpoint and immune library)DepositorInsertGln tRNA-gRNA scaffold
UseFor golden gate assemblyAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Gly-tRNA-gRNA scaffold for library 1
Plasmid#192368PurposetRNA sequence provider (for immune library)DepositorInsertGly tRNA-gRNA scaffold
UseFor golden gate assemblyAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Pro-tRNA-gRNA scaffold for library 1
Plasmid#192369PurposetRNA sequence provider (for immune library)DepositorInsertPro tRNA-gRNA scaffold
UseFor golden gate assemblyAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W2B)-PGKpuro2ABFP-W
Plasmid#163175PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of BFP tagDepositorAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W1K)-PGKpuro2ABFP-W
Plasmid#163174PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of BFP tagDepositorAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-gRNA(SFTPCI73Tcorr)-SpCas9(BB)-2A-GFP
Plasmid#187647PurposeEncodes gRNA to correct the SFTPC I73T mutationDepositorInsertI73T gRNA
UseCRISPRAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV-U6gRNA(BbsI)-PGKpuro2ABFP-L1mono3
Plasmid#73542PurposeExpression of sgRNA targeting LINE-1 and TagBFPDepositorInsertLINE-1
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV-U6gRNA(BbsI)-PGKpuro2ABFP-L1mono1
Plasmid#73543PurposeExpression of sgRNA targeting LINE-1 and TagBFPDepositorInsertLINE-1
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Flag-Mcm2 targeting sgRNA
Plasmid#186937PurposeGenomic targeting of Flag tag at Mcm2 N-terminalDepositorAvailable SinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-RDH11
Plasmid#161924PurposeTo generate RDH11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against RDH11 exon 2.DepositorInsertsgRNA targeting RDH11 exon 2
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA KanR neo_zhang2.0
Plasmid#167917PurposeLentiviral vector for expressing U6 MS2-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only